Incidental Mutation 'R4273:Dazap2'
ID 322295
Institutional Source Beutler Lab
Gene Symbol Dazap2
Ensembl Gene ENSMUSG00000000346
Gene Name DAZ associated protein 2
Synonyms Gcap28, Prtb, Brbp, gt6-12
MMRRC Submission 041645-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4273 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 100513543-100518642 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 100515971 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Threonine at position 100 (P100T)
Ref Sequence ENSEMBL: ENSMUSP00000000356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000356] [ENSMUST00000066068] [ENSMUST00000172334] [ENSMUST00000229307] [ENSMUST00000229965] [ENSMUST00000230280] [ENSMUST00000230517]
AlphaFold Q9DCP9
Predicted Effect probably damaging
Transcript: ENSMUST00000000356
AA Change: P100T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000356
Gene: ENSMUSG00000000346
AA Change: P100T

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
Pfam:DAZAP2 35 168 7.1e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066068
SMART Domains Protein: ENSMUSP00000066137
Gene: ENSMUSG00000053559

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172334
SMART Domains Protein: ENSMUSP00000126870
Gene: ENSMUSG00000053559

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181034
Predicted Effect probably benign
Transcript: ENSMUST00000229307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229424
Predicted Effect probably benign
Transcript: ENSMUST00000229965
Predicted Effect probably benign
Transcript: ENSMUST00000230280
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230384
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230712
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230661
Predicted Effect probably benign
Transcript: ENSMUST00000230517
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a proline-rich protein which interacts with the deleted in azoospermia (DAZ) and the deleted in azoospermia-like gene through the DAZ-like repeats. This protein also interacts with the transforming growth factor-beta signaling molecule SARA (Smad anchor for receptor activation), eukaryotic initiation factor 4G, and an E3 ubiquitinase that regulates its stability in splicing factor containing nuclear speckles. The encoded protein may function in various biological and pathological processes including spermatogenesis, cell signaling and transcription regulation, formation of stress granules during translation arrest, RNA splicing, and pathogenesis of multiple myeloma. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion are viable, fertile and do not exhibit motor coordination or balance defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,792,835 (GRCm39) probably null Het
Adgrf2 T A 17: 43,021,013 (GRCm39) T604S probably damaging Het
Akap8l T A 17: 32,540,905 (GRCm39) K533* probably null Het
Appbp2 T C 11: 85,125,502 (GRCm39) Y45C probably damaging Het
Arap2 T C 5: 62,828,322 (GRCm39) I950V possibly damaging Het
Arhgap31 T C 16: 38,422,697 (GRCm39) E1123G possibly damaging Het
Atp2c1 G T 9: 105,312,339 (GRCm39) N493K probably benign Het
Bcr T C 10: 74,960,943 (GRCm39) I458T probably damaging Het
Brd4 G A 17: 32,433,756 (GRCm39) T468I probably benign Het
Cdh23 T A 10: 60,146,940 (GRCm39) D2774V possibly damaging Het
Cfdp1 T C 8: 112,495,417 (GRCm39) Y267C probably damaging Het
Chd6 C A 2: 160,803,211 (GRCm39) A2156S probably benign Het
Disp1 T A 1: 182,869,208 (GRCm39) I1071F possibly damaging Het
Dlgap1 T A 17: 71,073,038 (GRCm39) S686T probably benign Het
Dst C T 1: 34,231,421 (GRCm39) R3183C possibly damaging Het
Enpp4 T C 17: 44,412,698 (GRCm39) N279D probably benign Het
Exoc3l T C 8: 106,016,593 (GRCm39) *740W probably null Het
Exoc5 A T 14: 49,252,937 (GRCm39) C625* probably null Het
Fam98b A T 2: 117,090,712 (GRCm39) N137Y possibly damaging Het
Fat4 T A 3: 38,945,776 (GRCm39) D1556E probably damaging Het
Fcer2a C A 8: 3,732,848 (GRCm39) V319L possibly damaging Het
Fer1l6 T C 15: 58,499,371 (GRCm39) V1247A probably benign Het
Fmo4 A G 1: 162,632,748 (GRCm39) V201A probably damaging Het
Fras1 G A 5: 96,762,763 (GRCm39) G755D probably benign Het
Grid2 T C 6: 63,886,029 (GRCm39) Y142H probably damaging Het
Hspg2 C T 4: 137,246,251 (GRCm39) R1010C probably damaging Het
Ibtk T C 9: 85,608,784 (GRCm39) Q376R probably damaging Het
Impdh2 T C 9: 108,442,155 (GRCm39) M414T probably damaging Het
Itm2c A G 1: 85,834,750 (GRCm39) T160A probably damaging Het
Kcna2 T A 3: 107,012,509 (GRCm39) D363E probably benign Het
Lama2 C T 10: 27,223,050 (GRCm39) C412Y probably damaging Het
Lims2 C G 18: 32,089,390 (GRCm39) T151S probably benign Het
Mier1 T C 4: 103,019,628 (GRCm39) S423P possibly damaging Het
Mrgpra3 A T 7: 47,239,180 (GRCm39) W249R probably benign Het
Mtor A G 4: 148,634,609 (GRCm39) H2410R probably benign Het
Mvp C T 7: 126,588,875 (GRCm39) A631T probably benign Het
Nepro T C 16: 44,556,192 (GRCm39) V450A possibly damaging Het
Ngrn T C 7: 79,914,269 (GRCm39) V140A probably damaging Het
Nobox T C 6: 43,282,942 (GRCm39) E231G probably benign Het
Or10al7 A T 17: 38,366,163 (GRCm39) I98N probably damaging Het
P3h2 T A 16: 25,923,971 (GRCm39) I155F probably benign Het
Pcdha3 C T 18: 37,081,144 (GRCm39) R629C probably damaging Het
Pramel24 A T 4: 143,453,416 (GRCm39) K175* probably null Het
Riok3 AGAAGCGG AG 18: 12,268,998 (GRCm39) probably benign Het
Rttn T C 18: 89,110,020 (GRCm39) I1675T probably benign Het
Sall2 C A 14: 52,551,260 (GRCm39) R643L probably damaging Het
Slc35f4 G T 14: 49,541,758 (GRCm39) T182N possibly damaging Het
Slc52a3 T A 2: 151,847,660 (GRCm39) I256N possibly damaging Het
Sox9 T C 11: 112,675,980 (GRCm39) S390P possibly damaging Het
Tango2 T C 16: 18,120,654 (GRCm39) probably benign Het
Tas1r1 T C 4: 152,116,614 (GRCm39) E340G possibly damaging Het
Tek G A 4: 94,718,207 (GRCm39) G524R probably damaging Het
Tmem260 A T 14: 48,742,761 (GRCm39) Y532F probably benign Het
Tsks C A 7: 44,607,353 (GRCm39) L559I probably damaging Het
Unc79 C A 12: 103,088,612 (GRCm39) L1702I probably damaging Het
Vmn1r14 T A 6: 57,211,133 (GRCm39) I237N probably damaging Het
Vmn2r17 G A 5: 109,600,832 (GRCm39) C710Y probably benign Het
Zfp119b G T 17: 56,245,926 (GRCm39) T420K possibly damaging Het
Zfp202 C T 9: 40,118,790 (GRCm39) R68* probably null Het
Zfp229 T A 17: 21,965,802 (GRCm39) S677R probably benign Het
Zfp462 C T 4: 55,008,411 (GRCm39) H126Y probably benign Het
Zfp52 C A 17: 21,780,459 (GRCm39) Y102* probably null Het
Zfp616 T A 11: 73,974,526 (GRCm39) M265K probably benign Het
Zfyve9 A T 4: 108,538,173 (GRCm39) I1031N probably damaging Het
Zmynd11 T C 13: 9,747,726 (GRCm39) Y203C probably damaging Het
Other mutations in Dazap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1521:Dazap2 UTSW 15 100,515,946 (GRCm39) nonsense probably null
R1724:Dazap2 UTSW 15 100,515,884 (GRCm39) missense probably damaging 0.99
R6251:Dazap2 UTSW 15 100,514,864 (GRCm39) missense possibly damaging 0.95
R7344:Dazap2 UTSW 15 100,514,824 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAGCTCTATCGTCCAAGCTTTG -3'
(R):5'- TGTGTCCAATGCCCTGATTG -3'

Sequencing Primer
(F):5'- CCAAGCTTTGTTCATCCAGGGG -3'
(R):5'- CCACATTTCTGCTCTGAGAGGG -3'
Posted On 2015-06-20