Mutagenetix > Incidental Mutation

Incidental Mutation 'R4273:Arhgap31'

322297

Institutional Source

Beutler Lab

Gene Symbol

Arhgap31

Ensembl Gene

ENSMUSG00000022799

Gene Name

Rho GTPase activating protein 31

Synonyms

CdGAP

MMRRC Submission

041645-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.309) question?

Stock #

R4273 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

38598340-38713274 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 38602335 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1123 (E1123G)

Ref Sequence

ENSEMBL: ENSMUSP00000023487 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023487]

AlphaFold

A6X8Z5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000023487
AA Change: E1123G

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000023487
Gene: ENSMUSG00000022799
AA Change: E1123G

Domain	Start	End	E-Value	Type
RhoGAP	32	213	1.04e-60	SMART
low complexity region	291	303	N/A	INTRINSIC
low complexity region	503	522	N/A	INTRINSIC
low complexity region	670	683	N/A	INTRINSIC
low complexity region	722	733	N/A	INTRINSIC
low complexity region	766	786	N/A	INTRINSIC

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.7%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase-activating protein (GAP). A variety of cellular processes are regulated by Rho GTPases which cycle between an inactive form bound to GDP and an active form bound to GTP. This cycling between inactive and active forms is regulated by guanine nucleotide exchange factors and GAPs. The encoded protein is a GAP shown to regulate two GTPases involved in protein trafficking and cell growth. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acer2	T	A	4: 86,874,598		probably null	Het
Adgrf2	T	A	17: 42,710,122	T604S	probably damaging	Het
Akap8l	T	A	17: 32,321,931	K533*	probably null	Het
Appbp2	T	C	11: 85,234,676	Y45C	probably damaging	Het
Arap2	T	C	5: 62,670,979	I950V	possibly damaging	Het
Atp2c1	G	T	9: 105,435,140	N493K	probably benign	Het
Bcr	T	C	10: 75,125,111	I458T	probably damaging	Het
Brd4	G	A	17: 32,214,782	T468I	probably benign	Het
Cdh23	T	A	10: 60,311,161	D2774V	possibly damaging	Het
Cfdp1	T	C	8: 111,768,785	Y267C	probably damaging	Het
Chd6	C	A	2: 160,961,291	A2156S	probably benign	Het
Dazap2	C	A	15: 100,618,090	P100T	probably damaging	Het
Disp1	T	A	1: 183,087,644	I1071F	possibly damaging	Het
Dlgap1	T	A	17: 70,766,043	S686T	probably benign	Het
Dst	C	T	1: 34,192,340	R3183C	possibly damaging	Het
Enpp4	T	C	17: 44,101,807	N279D	probably benign	Het
Exoc3l	T	C	8: 105,289,961	*740W	probably null	Het
Exoc5	A	T	14: 49,015,480	C625*	probably null	Het
Fam98b	A	T	2: 117,260,231	N137Y	possibly damaging	Het
Fat4	T	A	3: 38,891,627	D1556E	probably damaging	Het
Fcer2a	C	A	8: 3,682,848	V319L	possibly damaging	Het
Fer1l6	T	C	15: 58,627,522	V1247A	probably benign	Het
Fmo4	A	G	1: 162,805,179	V201A	probably damaging	Het
Fras1	G	A	5: 96,614,904	G755D	probably benign	Het
Gm13078	A	T	4: 143,726,846	K175*	probably null	Het
Grid2	T	C	6: 63,909,045	Y142H	probably damaging	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Ibtk	T	C	9: 85,726,731	Q376R	probably damaging	Het
Impdh2	T	C	9: 108,564,956	M414T	probably damaging	Het
Itm2c	A	G	1: 85,907,029	T160A	probably damaging	Het
Kcna2	T	A	3: 107,105,193	D363E	probably benign	Het
Lama2	C	T	10: 27,347,054	C412Y	probably damaging	Het
Lims2	C	G	18: 31,956,337	T151S	probably benign	Het
Mier1	T	C	4: 103,162,431	S423P	possibly damaging	Het
Mrgpra3	A	T	7: 47,589,432	W249R	probably benign	Het
Mtor	A	G	4: 148,550,152	H2410R	probably benign	Het
Mvp	C	T	7: 126,989,703	A631T	probably benign	Het
Nepro	T	C	16: 44,735,829	V450A	possibly damaging	Het
Ngrn	T	C	7: 80,264,521	V140A	probably damaging	Het
Nobox	T	C	6: 43,306,008	E231G	probably benign	Het
Olfr129	A	T	17: 38,055,272	I98N	probably damaging	Het
P3h2	T	A	16: 26,105,221	I155F	probably benign	Het
Pcdha3	C	T	18: 36,948,091	R629C	probably damaging	Het
Riok3	AGAAGCGG	AG	18: 12,135,941		probably benign	Het
Rttn	T	C	18: 89,091,896	I1675T	probably benign	Het
Sall2	C	A	14: 52,313,803	R643L	probably damaging	Het
Slc35f4	G	T	14: 49,304,301	T182N	possibly damaging	Het
Slc52a3	T	A	2: 152,005,740	I256N	possibly damaging	Het
Sox9	T	C	11: 112,785,154	S390P	possibly damaging	Het
Tango2	T	C	16: 18,302,790		probably benign	Het
Tas1r1	T	C	4: 152,032,157	E340G	possibly damaging	Het
Tek	G	A	4: 94,829,970	G524R	probably damaging	Het
Tmem260	A	T	14: 48,505,304	Y532F	probably benign	Het
Tsks	C	A	7: 44,957,929	L559I	probably damaging	Het
Unc79	C	A	12: 103,122,353	L1702I	probably damaging	Het
Vmn1r14	T	A	6: 57,234,148	I237N	probably damaging	Het
Vmn2r17	G	A	5: 109,452,966	C710Y	probably benign	Het
Zfp119b	G	T	17: 55,938,926	T420K	possibly damaging	Het
Zfp202	C	T	9: 40,207,494	R68*	probably null	Het
Zfp229	T	A	17: 21,746,821	S677R	probably benign	Het
Zfp462	C	T	4: 55,008,411	H126Y	probably benign	Het
Zfp52	C	A	17: 21,560,197	Y102*	probably null	Het
Zfp616	T	A	11: 74,083,700	M265K	probably benign	Het
Zfyve9	A	T	4: 108,680,976	I1031N	probably damaging	Het
Zmynd11	T	C	13: 9,697,690	Y203C	probably damaging	Het

Other mutations in Arhgap31

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00741:Arhgap31	APN	16	38603001	missense	probably damaging	1.00
IGL01062:Arhgap31	APN	16	38601456	missense	probably damaging	1.00
IGL01152:Arhgap31	APN	16	38602239	missense	possibly damaging	0.49
IGL01680:Arhgap31	APN	16	38603614	missense	probably benign	0.04
IGL01739:Arhgap31	APN	16	38603431	missense	probably benign
IGL01870:Arhgap31	APN	16	38618242	missense	probably damaging	1.00
IGL01936:Arhgap31	APN	16	38602925	missense	probably damaging	1.00
IGL01981:Arhgap31	APN	16	38601573	missense	probably damaging	1.00
IGL01983:Arhgap31	APN	16	38601765	missense	probably damaging	1.00
IGL02157:Arhgap31	APN	16	38623901	missense	probably damaging	1.00
IGL02629:Arhgap31	APN	16	38609164	missense	probably benign	0.00
IGL03375:Arhgap31	APN	16	38602828	missense	probably damaging	1.00
PIT4283001:Arhgap31	UTSW	16	38608992	missense	probably damaging	1.00
R0271:Arhgap31	UTSW	16	38602510	missense	possibly damaging	0.61
R1325:Arhgap31	UTSW	16	38602942	missense	probably benign	0.00
R1753:Arhgap31	UTSW	16	38601612	missense	possibly damaging	0.92
R1766:Arhgap31	UTSW	16	38625590	missense	probably damaging	1.00
R1834:Arhgap31	UTSW	16	38603703	missense	probably benign	0.02
R2104:Arhgap31	UTSW	16	38625579	missense	probably benign	0.03
R2261:Arhgap31	UTSW	16	38609277	missense	probably damaging	1.00
R3011:Arhgap31	UTSW	16	38601907	missense	possibly damaging	0.58
R3712:Arhgap31	UTSW	16	38602533	missense	possibly damaging	0.91
R3757:Arhgap31	UTSW	16	38637000	missense	probably damaging	1.00
R3953:Arhgap31	UTSW	16	38603464	missense	probably benign	0.00
R4105:Arhgap31	UTSW	16	38602426	missense	probably damaging	1.00
R4107:Arhgap31	UTSW	16	38602426	missense	probably damaging	1.00
R4108:Arhgap31	UTSW	16	38602426	missense	probably damaging	1.00
R4109:Arhgap31	UTSW	16	38602426	missense	probably damaging	1.00
R4198:Arhgap31	UTSW	16	38623913	missense	probably damaging	1.00
R4200:Arhgap31	UTSW	16	38623913	missense	probably damaging	1.00
R5020:Arhgap31	UTSW	16	38603076	missense	probably damaging	1.00
R5100:Arhgap31	UTSW	16	38601459	missense	probably damaging	1.00
R6516:Arhgap31	UTSW	16	38609404	missense	possibly damaging	0.47
R6879:Arhgap31	UTSW	16	38602314	missense	probably benign
R7341:Arhgap31	UTSW	16	38712514	splice site	probably null
R7880:Arhgap31	UTSW	16	38602725	missense	probably benign	0.37
R7884:Arhgap31	UTSW	16	38602231	missense	probably damaging	0.97
R8156:Arhgap31	UTSW	16	38625629	missense	probably damaging	1.00
R8223:Arhgap31	UTSW	16	38603722	missense	probably benign	0.21
R8413:Arhgap31	UTSW	16	38602921	missense	possibly damaging	0.76
R8545:Arhgap31	UTSW	16	38603046	missense	probably damaging	0.98
R8679:Arhgap31	UTSW	16	38602604	missense	probably damaging	0.97
R8721:Arhgap31	UTSW	16	38606696	missense	probably benign
R8815:Arhgap31	UTSW	16	38609428	missense	probably benign
R9056:Arhgap31	UTSW	16	38606655	missense	probably benign	0.00
R9077:Arhgap31	UTSW	16	38602368	missense	probably damaging	0.98
R9251:Arhgap31	UTSW	16	38602856	missense	probably benign
R9382:Arhgap31	UTSW	16	38602626	missense	probably benign	0.14
R9500:Arhgap31	UTSW	16	38640321	missense	probably damaging	1.00
R9544:Arhgap31	UTSW	16	38603614	missense	probably damaging	0.99
X0063:Arhgap31	UTSW	16	38602398	missense	probably damaging	0.99
Z1176:Arhgap31	UTSW	16	38623893	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- CACATTTTGACCATGAAGGAGG -3'
(R):5'- AAACACAGTGATGTTCCCGG -3'

Sequencing Primer
(F):5'- TTGACCATGAAGGAGGTTCTCAC -3'
(R):5'- TGATGTTCCCGGGCCAGATAG -3'

Posted On

2015-06-20