Incidental Mutation 'R4273:Brd4'
ID 322301
Institutional Source Beutler Lab
Gene Symbol Brd4
Ensembl Gene ENSMUSG00000024002
Gene Name bromodomain containing 4
Synonyms WI-11513, HUNK1, MCAP
MMRRC Submission 041645-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4273 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 32415248-32503696 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 32433756 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 468 (T468I)
Ref Sequence ENSEMBL: ENSMUSP00000115163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003726] [ENSMUST00000114475] [ENSMUST00000119123] [ENSMUST00000120276] [ENSMUST00000121285] [ENSMUST00000125899] [ENSMUST00000127893]
AlphaFold Q9ESU6
Predicted Effect unknown
Transcript: ENSMUST00000003726
AA Change: T469I
SMART Domains Protein: ENSMUSP00000003726
Gene: ENSMUSG00000024002
AA Change: T469I

DomainStartEndE-ValueType
low complexity region 23 54 N/A INTRINSIC
BROMO 56 166 1e-52 SMART
low complexity region 176 191 N/A INTRINSIC
low complexity region 198 224 N/A INTRINSIC
low complexity region 237 275 N/A INTRINSIC
low complexity region 295 305 N/A INTRINSIC
low complexity region 329 339 N/A INTRINSIC
BROMO 352 461 1.2e-48 SMART
coiled coil region 504 570 N/A INTRINSIC
Pfam:BET 611 675 6.4e-33 PFAM
low complexity region 701 722 N/A INTRINSIC
low complexity region 746 796 N/A INTRINSIC
low complexity region 828 854 N/A INTRINSIC
low complexity region 890 926 N/A INTRINSIC
low complexity region 929 939 N/A INTRINSIC
low complexity region 953 1005 N/A INTRINSIC
low complexity region 1013 1042 N/A INTRINSIC
low complexity region 1086 1100 N/A INTRINSIC
low complexity region 1105 1120 N/A INTRINSIC
low complexity region 1135 1147 N/A INTRINSIC
low complexity region 1201 1212 N/A INTRINSIC
low complexity region 1248 1260 N/A INTRINSIC
coiled coil region 1261 1345 N/A INTRINSIC
Pfam:BRD4_CDT 1358 1400 3.8e-24 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000114475
AA Change: T468I
SMART Domains Protein: ENSMUSP00000110119
Gene: ENSMUSG00000024002
AA Change: T468I

DomainStartEndE-ValueType
low complexity region 23 54 N/A INTRINSIC
BROMO 56 166 1.67e-50 SMART
low complexity region 197 223 N/A INTRINSIC
low complexity region 236 274 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
BROMO 351 460 1.81e-46 SMART
coiled coil region 503 569 N/A INTRINSIC
PDB:2JNS|A 606 683 3e-46 PDB
low complexity region 700 720 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000119123
AA Change: T468I
SMART Domains Protein: ENSMUSP00000113197
Gene: ENSMUSG00000024002
AA Change: T468I

DomainStartEndE-ValueType
low complexity region 23 54 N/A INTRINSIC
BROMO 56 166 1.67e-50 SMART
low complexity region 197 223 N/A INTRINSIC
low complexity region 236 274 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
BROMO 351 460 1.81e-46 SMART
coiled coil region 503 569 N/A INTRINSIC
PDB:2JNS|A 606 683 6e-46 PDB
low complexity region 700 721 N/A INTRINSIC
low complexity region 745 795 N/A INTRINSIC
low complexity region 827 853 N/A INTRINSIC
low complexity region 889 925 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 952 1004 N/A INTRINSIC
low complexity region 1012 1041 N/A INTRINSIC
low complexity region 1085 1099 N/A INTRINSIC
low complexity region 1104 1119 N/A INTRINSIC
low complexity region 1134 1146 N/A INTRINSIC
low complexity region 1200 1211 N/A INTRINSIC
low complexity region 1247 1259 N/A INTRINSIC
coiled coil region 1260 1344 N/A INTRINSIC
low complexity region 1361 1381 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000120276
AA Change: T468I
SMART Domains Protein: ENSMUSP00000112474
Gene: ENSMUSG00000024002
AA Change: T468I

DomainStartEndE-ValueType
low complexity region 23 54 N/A INTRINSIC
BROMO 56 166 1.67e-50 SMART
low complexity region 197 223 N/A INTRINSIC
low complexity region 236 274 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
BROMO 351 460 1.81e-46 SMART
coiled coil region 503 569 N/A INTRINSIC
PDB:2JNS|A 606 683 3e-46 PDB
low complexity region 700 721 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000121285
AA Change: T468I
SMART Domains Protein: ENSMUSP00000113070
Gene: ENSMUSG00000024002
AA Change: T468I

DomainStartEndE-ValueType
low complexity region 23 54 N/A INTRINSIC
BROMO 56 166 1.67e-50 SMART
low complexity region 197 223 N/A INTRINSIC
low complexity region 236 274 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
BROMO 351 460 1.81e-46 SMART
coiled coil region 503 569 N/A INTRINSIC
PDB:2JNS|A 606 683 6e-46 PDB
low complexity region 700 721 N/A INTRINSIC
low complexity region 745 795 N/A INTRINSIC
low complexity region 827 853 N/A INTRINSIC
low complexity region 889 925 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 952 1004 N/A INTRINSIC
low complexity region 1012 1041 N/A INTRINSIC
low complexity region 1085 1099 N/A INTRINSIC
low complexity region 1104 1119 N/A INTRINSIC
low complexity region 1134 1146 N/A INTRINSIC
low complexity region 1200 1211 N/A INTRINSIC
low complexity region 1247 1259 N/A INTRINSIC
coiled coil region 1260 1344 N/A INTRINSIC
low complexity region 1361 1381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125899
SMART Domains Protein: ENSMUSP00000115277
Gene: ENSMUSG00000024002

DomainStartEndE-ValueType
low complexity region 23 54 N/A INTRINSIC
BROMO 56 144 5.02e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127893
AA Change: T468I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115163
Gene: ENSMUSG00000024002
AA Change: T468I

DomainStartEndE-ValueType
low complexity region 23 54 N/A INTRINSIC
BROMO 56 166 1.67e-50 SMART
low complexity region 197 223 N/A INTRINSIC
low complexity region 236 274 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
BROMO 351 460 1.81e-46 SMART
coiled coil region 503 531 N/A INTRINSIC
low complexity region 536 557 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene was temporarily named bromodomain-containing 5 (Brd5) and was renamed bromodomain-containing 4 (Brd4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a gene-trap null mutation die soon after implantation. Heterozygotes exhibit impaired pre- and postnatal growth, head malformations, lack of subcutaneous fat, cataracts, and abnormal liver cells. [provided by MGI curators]
Allele List at MGI

All alleles(161) : Targeted(1) Gene trapped(160)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,792,835 (GRCm39) probably null Het
Adgrf2 T A 17: 43,021,013 (GRCm39) T604S probably damaging Het
Akap8l T A 17: 32,540,905 (GRCm39) K533* probably null Het
Appbp2 T C 11: 85,125,502 (GRCm39) Y45C probably damaging Het
Arap2 T C 5: 62,828,322 (GRCm39) I950V possibly damaging Het
Arhgap31 T C 16: 38,422,697 (GRCm39) E1123G possibly damaging Het
Atp2c1 G T 9: 105,312,339 (GRCm39) N493K probably benign Het
Bcr T C 10: 74,960,943 (GRCm39) I458T probably damaging Het
Cdh23 T A 10: 60,146,940 (GRCm39) D2774V possibly damaging Het
Cfdp1 T C 8: 112,495,417 (GRCm39) Y267C probably damaging Het
Chd6 C A 2: 160,803,211 (GRCm39) A2156S probably benign Het
Dazap2 C A 15: 100,515,971 (GRCm39) P100T probably damaging Het
Disp1 T A 1: 182,869,208 (GRCm39) I1071F possibly damaging Het
Dlgap1 T A 17: 71,073,038 (GRCm39) S686T probably benign Het
Dst C T 1: 34,231,421 (GRCm39) R3183C possibly damaging Het
Enpp4 T C 17: 44,412,698 (GRCm39) N279D probably benign Het
Exoc3l T C 8: 106,016,593 (GRCm39) *740W probably null Het
Exoc5 A T 14: 49,252,937 (GRCm39) C625* probably null Het
Fam98b A T 2: 117,090,712 (GRCm39) N137Y possibly damaging Het
Fat4 T A 3: 38,945,776 (GRCm39) D1556E probably damaging Het
Fcer2a C A 8: 3,732,848 (GRCm39) V319L possibly damaging Het
Fer1l6 T C 15: 58,499,371 (GRCm39) V1247A probably benign Het
Fmo4 A G 1: 162,632,748 (GRCm39) V201A probably damaging Het
Fras1 G A 5: 96,762,763 (GRCm39) G755D probably benign Het
Grid2 T C 6: 63,886,029 (GRCm39) Y142H probably damaging Het
Hspg2 C T 4: 137,246,251 (GRCm39) R1010C probably damaging Het
Ibtk T C 9: 85,608,784 (GRCm39) Q376R probably damaging Het
Impdh2 T C 9: 108,442,155 (GRCm39) M414T probably damaging Het
Itm2c A G 1: 85,834,750 (GRCm39) T160A probably damaging Het
Kcna2 T A 3: 107,012,509 (GRCm39) D363E probably benign Het
Lama2 C T 10: 27,223,050 (GRCm39) C412Y probably damaging Het
Lims2 C G 18: 32,089,390 (GRCm39) T151S probably benign Het
Mier1 T C 4: 103,019,628 (GRCm39) S423P possibly damaging Het
Mrgpra3 A T 7: 47,239,180 (GRCm39) W249R probably benign Het
Mtor A G 4: 148,634,609 (GRCm39) H2410R probably benign Het
Mvp C T 7: 126,588,875 (GRCm39) A631T probably benign Het
Nepro T C 16: 44,556,192 (GRCm39) V450A possibly damaging Het
Ngrn T C 7: 79,914,269 (GRCm39) V140A probably damaging Het
Nobox T C 6: 43,282,942 (GRCm39) E231G probably benign Het
Or10al7 A T 17: 38,366,163 (GRCm39) I98N probably damaging Het
P3h2 T A 16: 25,923,971 (GRCm39) I155F probably benign Het
Pcdha3 C T 18: 37,081,144 (GRCm39) R629C probably damaging Het
Pramel24 A T 4: 143,453,416 (GRCm39) K175* probably null Het
Riok3 AGAAGCGG AG 18: 12,268,998 (GRCm39) probably benign Het
Rttn T C 18: 89,110,020 (GRCm39) I1675T probably benign Het
Sall2 C A 14: 52,551,260 (GRCm39) R643L probably damaging Het
Slc35f4 G T 14: 49,541,758 (GRCm39) T182N possibly damaging Het
Slc52a3 T A 2: 151,847,660 (GRCm39) I256N possibly damaging Het
Sox9 T C 11: 112,675,980 (GRCm39) S390P possibly damaging Het
Tango2 T C 16: 18,120,654 (GRCm39) probably benign Het
Tas1r1 T C 4: 152,116,614 (GRCm39) E340G possibly damaging Het
Tek G A 4: 94,718,207 (GRCm39) G524R probably damaging Het
Tmem260 A T 14: 48,742,761 (GRCm39) Y532F probably benign Het
Tsks C A 7: 44,607,353 (GRCm39) L559I probably damaging Het
Unc79 C A 12: 103,088,612 (GRCm39) L1702I probably damaging Het
Vmn1r14 T A 6: 57,211,133 (GRCm39) I237N probably damaging Het
Vmn2r17 G A 5: 109,600,832 (GRCm39) C710Y probably benign Het
Zfp119b G T 17: 56,245,926 (GRCm39) T420K possibly damaging Het
Zfp202 C T 9: 40,118,790 (GRCm39) R68* probably null Het
Zfp229 T A 17: 21,965,802 (GRCm39) S677R probably benign Het
Zfp462 C T 4: 55,008,411 (GRCm39) H126Y probably benign Het
Zfp52 C A 17: 21,780,459 (GRCm39) Y102* probably null Het
Zfp616 T A 11: 73,974,526 (GRCm39) M265K probably benign Het
Zfyve9 A T 4: 108,538,173 (GRCm39) I1031N probably damaging Het
Zmynd11 T C 13: 9,747,726 (GRCm39) Y203C probably damaging Het
Other mutations in Brd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01736:Brd4 APN 17 32,417,649 (GRCm39) splice site probably benign
IGL01758:Brd4 APN 17 32,431,803 (GRCm39) unclassified probably benign
IGL02750:Brd4 APN 17 32,417,353 (GRCm39) unclassified probably benign
IGL03066:Brd4 APN 17 32,418,062 (GRCm39) intron probably benign
IGL03338:Brd4 APN 17 32,432,046 (GRCm39) missense probably damaging 1.00
Admirable UTSW 17 32,444,557 (GRCm39) missense unknown
H8562:Brd4 UTSW 17 32,448,377 (GRCm39) splice site probably benign
P0035:Brd4 UTSW 17 32,431,812 (GRCm39) critical splice donor site probably null
R0243:Brd4 UTSW 17 32,443,097 (GRCm39) missense probably benign 0.15
R0281:Brd4 UTSW 17 32,432,514 (GRCm39) unclassified probably benign
R0331:Brd4 UTSW 17 32,421,489 (GRCm39) missense probably benign 0.01
R0722:Brd4 UTSW 17 32,431,956 (GRCm39) missense possibly damaging 0.76
R0750:Brd4 UTSW 17 32,439,226 (GRCm39) missense probably benign 0.09
R1544:Brd4 UTSW 17 32,417,646 (GRCm39) splice site probably benign
R1920:Brd4 UTSW 17 32,417,060 (GRCm39) unclassified probably benign
R1922:Brd4 UTSW 17 32,417,060 (GRCm39) unclassified probably benign
R1957:Brd4 UTSW 17 32,440,340 (GRCm39) missense possibly damaging 0.50
R2240:Brd4 UTSW 17 32,432,613 (GRCm39) unclassified probably benign
R2316:Brd4 UTSW 17 32,431,884 (GRCm39) missense probably benign 0.03
R2333:Brd4 UTSW 17 32,440,431 (GRCm39) missense probably damaging 0.97
R3809:Brd4 UTSW 17 32,430,244 (GRCm39) missense possibly damaging 0.72
R4595:Brd4 UTSW 17 32,417,896 (GRCm39) missense probably damaging 0.97
R4854:Brd4 UTSW 17 32,439,211 (GRCm39) missense probably damaging 0.96
R4923:Brd4 UTSW 17 32,418,214 (GRCm39) missense probably benign 0.38
R5014:Brd4 UTSW 17 32,417,372 (GRCm39) unclassified probably benign
R5757:Brd4 UTSW 17 32,420,272 (GRCm39) unclassified probably benign
R5979:Brd4 UTSW 17 32,417,700 (GRCm39) missense probably benign 0.32
R6212:Brd4 UTSW 17 32,421,423 (GRCm39) missense probably damaging 0.98
R6394:Brd4 UTSW 17 32,443,121 (GRCm39) nonsense probably null
R6643:Brd4 UTSW 17 32,417,470 (GRCm39) missense unknown
R7024:Brd4 UTSW 17 32,440,884 (GRCm39) utr 3 prime probably benign
R7033:Brd4 UTSW 17 32,417,989 (GRCm39) missense probably benign 0.13
R7220:Brd4 UTSW 17 32,444,557 (GRCm39) missense unknown
R7682:Brd4 UTSW 17 32,420,134 (GRCm39) missense unknown
R7731:Brd4 UTSW 17 32,430,198 (GRCm39) missense possibly damaging 0.73
R7732:Brd4 UTSW 17 32,440,386 (GRCm39) missense unknown
R7750:Brd4 UTSW 17 32,432,521 (GRCm39) missense unknown
R7756:Brd4 UTSW 17 32,417,956 (GRCm39) missense unknown
R7758:Brd4 UTSW 17 32,417,956 (GRCm39) missense unknown
R7779:Brd4 UTSW 17 32,431,910 (GRCm39) missense probably benign 0.03
R8214:Brd4 UTSW 17 32,431,921 (GRCm39) missense probably benign 0.19
R8405:Brd4 UTSW 17 32,448,505 (GRCm39) missense unknown
R9675:Brd4 UTSW 17 32,433,786 (GRCm39) missense unknown
X0064:Brd4 UTSW 17 32,420,101 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCTGGCTTCTGCACATAAAACC -3'
(R):5'- GCTCATGGCCTAACACTTACTAAG -3'

Sequencing Primer
(F):5'- TGGCTTCTGCACATAAAACCAGATTC -3'
(R):5'- TGGCCTAACACTTACTAAGAACCCTC -3'
Posted On 2015-06-20