Mutagenetix > Incidental Mutation

Incidental Mutation 'R4273:Akap8l'

322302

Institutional Source

Beutler Lab

Gene Symbol

Akap8l

Ensembl Gene

ENSMUSG00000002625

Gene Name

A kinase (PRKA) anchor protein 8-like

Synonyms

Nakap95

MMRRC Submission

041645-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.576) question?

Stock #

R4273 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

32321425-32350581 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 32321931 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 533 (K533*)

Ref Sequence

ENSEMBL: ENSMUSP00000051389 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002699] [ENSMUST00000050214]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000002699

SMART Domains

Protein: ENSMUSP00000002699
Gene: ENSMUSG00000024045

Domain	Start	End	E-Value	Type
SCOP:d1a0tp_	12	108	3e-19	SMART
low complexity region	183	198	N/A	INTRINSIC
low complexity region	257	270	N/A	INTRINSIC
low complexity region	354	384	N/A	INTRINSIC
ZnF_C2H2	387	411	9.46e0	SMART
Blast:ZnF_C2H2	476	501	9e-9	BLAST
low complexity region	551	582	N/A	INTRINSIC
low complexity region	642	651	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000050214
AA Change: K533*

SMART Domains

Protein: ENSMUSP00000051389
Gene: ENSMUSG00000002625
AA Change: K533*

Domain	Start	End	E-Value	Type
low complexity region	37	62	N/A	INTRINSIC
low complexity region	78	93	N/A	INTRINSIC
low complexity region	112	120	N/A	INTRINSIC
low complexity region	236	257	N/A	INTRINSIC
low complexity region	296	306	N/A	INTRINSIC
low complexity region	307	324	N/A	INTRINSIC
low complexity region	330	350	N/A	INTRINSIC
coiled coil region	356	383	N/A	INTRINSIC
ZnF_C2H2	389	413	1.05e1	SMART
SCOP:d1jvr__	538	613	7e-5	SMART
low complexity region	628	640	N/A	INTRINSIC

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.7%
20x: 96.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acer2	T	A	4: 86,874,598		probably null	Het
Adgrf2	T	A	17: 42,710,122	T604S	probably damaging	Het
Appbp2	T	C	11: 85,234,676	Y45C	probably damaging	Het
Arap2	T	C	5: 62,670,979	I950V	possibly damaging	Het
Arhgap31	T	C	16: 38,602,335	E1123G	possibly damaging	Het
Atp2c1	G	T	9: 105,435,140	N493K	probably benign	Het
Bcr	T	C	10: 75,125,111	I458T	probably damaging	Het
Brd4	G	A	17: 32,214,782	T468I	probably benign	Het
Cdh23	T	A	10: 60,311,161	D2774V	possibly damaging	Het
Cfdp1	T	C	8: 111,768,785	Y267C	probably damaging	Het
Chd6	C	A	2: 160,961,291	A2156S	probably benign	Het
Dazap2	C	A	15: 100,618,090	P100T	probably damaging	Het
Disp1	T	A	1: 183,087,644	I1071F	possibly damaging	Het
Dlgap1	T	A	17: 70,766,043	S686T	probably benign	Het
Dst	C	T	1: 34,192,340	R3183C	possibly damaging	Het
Enpp4	T	C	17: 44,101,807	N279D	probably benign	Het
Exoc3l	T	C	8: 105,289,961	*740W	probably null	Het
Exoc5	A	T	14: 49,015,480	C625*	probably null	Het
Fam98b	A	T	2: 117,260,231	N137Y	possibly damaging	Het
Fat4	T	A	3: 38,891,627	D1556E	probably damaging	Het
Fcer2a	C	A	8: 3,682,848	V319L	possibly damaging	Het
Fer1l6	T	C	15: 58,627,522	V1247A	probably benign	Het
Fmo4	A	G	1: 162,805,179	V201A	probably damaging	Het
Fras1	G	A	5: 96,614,904	G755D	probably benign	Het
Gm13078	A	T	4: 143,726,846	K175*	probably null	Het
Grid2	T	C	6: 63,909,045	Y142H	probably damaging	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Ibtk	T	C	9: 85,726,731	Q376R	probably damaging	Het
Impdh2	T	C	9: 108,564,956	M414T	probably damaging	Het
Itm2c	A	G	1: 85,907,029	T160A	probably damaging	Het
Kcna2	T	A	3: 107,105,193	D363E	probably benign	Het
Lama2	C	T	10: 27,347,054	C412Y	probably damaging	Het
Lims2	C	G	18: 31,956,337	T151S	probably benign	Het
Mier1	T	C	4: 103,162,431	S423P	possibly damaging	Het
Mrgpra3	A	T	7: 47,589,432	W249R	probably benign	Het
Mtor	A	G	4: 148,550,152	H2410R	probably benign	Het
Mvp	C	T	7: 126,989,703	A631T	probably benign	Het
Nepro	T	C	16: 44,735,829	V450A	possibly damaging	Het
Ngrn	T	C	7: 80,264,521	V140A	probably damaging	Het
Nobox	T	C	6: 43,306,008	E231G	probably benign	Het
Olfr129	A	T	17: 38,055,272	I98N	probably damaging	Het
P3h2	T	A	16: 26,105,221	I155F	probably benign	Het
Pcdha3	C	T	18: 36,948,091	R629C	probably damaging	Het
Riok3	AGAAGCGG	AG	18: 12,135,941		probably benign	Het
Rttn	T	C	18: 89,091,896	I1675T	probably benign	Het
Sall2	C	A	14: 52,313,803	R643L	probably damaging	Het
Slc35f4	G	T	14: 49,304,301	T182N	possibly damaging	Het
Slc52a3	T	A	2: 152,005,740	I256N	possibly damaging	Het
Sox9	T	C	11: 112,785,154	S390P	possibly damaging	Het
Tango2	T	C	16: 18,302,790		probably benign	Het
Tas1r1	T	C	4: 152,032,157	E340G	possibly damaging	Het
Tek	G	A	4: 94,829,970	G524R	probably damaging	Het
Tmem260	A	T	14: 48,505,304	Y532F	probably benign	Het
Tsks	C	A	7: 44,957,929	L559I	probably damaging	Het
Unc79	C	A	12: 103,122,353	L1702I	probably damaging	Het
Vmn1r14	T	A	6: 57,234,148	I237N	probably damaging	Het
Vmn2r17	G	A	5: 109,452,966	C710Y	probably benign	Het
Zfp119b	G	T	17: 55,938,926	T420K	possibly damaging	Het
Zfp202	C	T	9: 40,207,494	R68*	probably null	Het
Zfp229	T	A	17: 21,746,821	S677R	probably benign	Het
Zfp462	C	T	4: 55,008,411	H126Y	probably benign	Het
Zfp52	C	A	17: 21,560,197	Y102*	probably null	Het
Zfp616	T	A	11: 74,083,700	M265K	probably benign	Het
Zfyve9	A	T	4: 108,680,976	I1031N	probably damaging	Het
Zmynd11	T	C	13: 9,697,690	Y203C	probably damaging	Het

Other mutations in Akap8l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00590:Akap8l	APN	17	32333097	missense	possibly damaging	0.82
IGL01603:Akap8l	APN	17	32345353	missense	probably damaging	1.00
IGL02028:Akap8l	APN	17	32338521	splice site	probably null
IGL02033:Akap8l	APN	17	32338272	missense	probably damaging	1.00
IGL02301:Akap8l	APN	17	32332926	splice site	probably benign
R1136:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R1137:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R1192:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R1277:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R1279:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R1703:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R1705:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R1706:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R1727:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R1763:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R1774:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R1796:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R1954:Akap8l	UTSW	17	32336736	missense	possibly damaging	0.74
R2072:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R2073:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R2074:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R2107:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R2108:Akap8l	UTSW	17	32332483	missense	probably damaging	1.00
R2214:Akap8l	UTSW	17	32338825	critical splice acceptor site	probably null
R2215:Akap8l	UTSW	17	32321595	missense	possibly damaging	0.72
R2219:Akap8l	UTSW	17	32334631	missense	probably benign	0.23
R2234:Akap8l	UTSW	17	32338803	missense	probably damaging	1.00
R2871:Akap8l	UTSW	17	32338442	missense	possibly damaging	0.84
R2871:Akap8l	UTSW	17	32338442	missense	possibly damaging	0.84
R4379:Akap8l	UTSW	17	32321514	unclassified	probably benign
R5061:Akap8l	UTSW	17	32332894	missense	probably damaging	1.00
R5337:Akap8l	UTSW	17	32336394	missense	possibly damaging	0.71
R5377:Akap8l	UTSW	17	32321511	unclassified	probably benign
R5579:Akap8l	UTSW	17	32321942	missense	probably damaging	1.00
R5609:Akap8l	UTSW	17	32338400	missense	probably damaging	1.00
R5667:Akap8l	UTSW	17	32338292	missense	probably damaging	1.00
R5671:Akap8l	UTSW	17	32338292	missense	probably damaging	1.00
R5747:Akap8l	UTSW	17	32345378	missense	probably damaging	0.97
R6186:Akap8l	UTSW	17	32333044	missense	probably benign	0.02
R6400:Akap8l	UTSW	17	32336320	missense	probably damaging	0.99
R6482:Akap8l	UTSW	17	32345396	missense	possibly damaging	0.94
R6712:Akap8l	UTSW	17	32332888	missense	probably damaging	1.00
R7165:Akap8l	UTSW	17	32338412	missense	probably damaging	0.99
R7485:Akap8l	UTSW	17	32335571	missense	probably benign	0.03
R7729:Akap8l	UTSW	17	32333094	missense	probably damaging	1.00
R9437:Akap8l	UTSW	17	32334634	missense	probably benign	0.24
R9651:Akap8l	UTSW	17	32338809	missense	probably damaging	1.00
R9652:Akap8l	UTSW	17	32338809	missense	probably damaging	1.00
V5088:Akap8l	UTSW	17	32336739	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GTTGTCAGTGAAAGGATTCTCGC -3'
(R):5'- GTGTGGGTGATCAGATCGAATC -3'

Sequencing Primer
(F):5'- AAAGGATTCTCGCCCTGTAG -3'
(R):5'- GGTGATCAGATCGAATCCTAGTTCC -3'

Posted On

2015-06-20