Incidental Mutation 'R4273:Dlgap1'
ID 322306
Institutional Source Beutler Lab
Gene Symbol Dlgap1
Ensembl Gene ENSMUSG00000003279
Gene Name DLG associated protein 1
Synonyms Sapap1, Gkap, GKAP/SAPAP, SAPAP1, D17Bwg0511e, DAP-1 beta, 4933422O14Rik
MMRRC Submission 041645-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4273 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 70276068-71128408 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 71073038 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 686 (S686T)
Ref Sequence ENSEMBL: ENSMUSP00000122896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060072] [ENSMUST00000097288] [ENSMUST00000133717] [ENSMUST00000133983] [ENSMUST00000135938] [ENSMUST00000140728] [ENSMUST00000146730] [ENSMUST00000148486] [ENSMUST00000155016]
AlphaFold Q9D415
Predicted Effect probably benign
Transcript: ENSMUST00000060072
AA Change: S676T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052858
Gene: ENSMUSG00000003279
AA Change: S676T

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 515 539 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
low complexity region 628 642 N/A INTRINSIC
Pfam:GKAP 643 982 6.8e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097288
AA Change: S378T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000094890
Gene: ENSMUSG00000003279
AA Change: S378T

DomainStartEndE-ValueType
low complexity region 208 228 N/A INTRINSIC
low complexity region 244 261 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
Pfam:GKAP 345 625 9.4e-106 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126801
Predicted Effect probably benign
Transcript: ENSMUST00000133717
AA Change: S360T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122370
Gene: ENSMUSG00000003279
AA Change: S360T

DomainStartEndE-ValueType
low complexity region 218 238 N/A INTRINSIC
low complexity region 312 326 N/A INTRINSIC
Pfam:GKAP 327 666 1.3e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133983
AA Change: S676T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116716
Gene: ENSMUSG00000003279
AA Change: S676T

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 515 539 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
low complexity region 628 642 N/A INTRINSIC
Pfam:GKAP 643 982 6.8e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135938
AA Change: S658T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118497
Gene: ENSMUSG00000003279
AA Change: S658T

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 516 536 N/A INTRINSIC
low complexity region 610 624 N/A INTRINSIC
Pfam:GKAP 625 964 9.3e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140728
AA Change: S386T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117358
Gene: ENSMUSG00000003279
AA Change: S386T

DomainStartEndE-ValueType
low complexity region 216 236 N/A INTRINSIC
low complexity region 252 269 N/A INTRINSIC
low complexity region 338 352 N/A INTRINSIC
Pfam:GKAP 353 692 1.4e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146730
AA Change: S686T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116072
Gene: ENSMUSG00000003279
AA Change: S686T

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 516 536 N/A INTRINSIC
low complexity region 552 569 N/A INTRINSIC
low complexity region 638 652 N/A INTRINSIC
Pfam:GKAP 653 933 9.5e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148486
AA Change: S376T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122337
Gene: ENSMUSG00000003279
AA Change: S376T

DomainStartEndE-ValueType
low complexity region 215 239 N/A INTRINSIC
low complexity region 242 259 N/A INTRINSIC
low complexity region 328 342 N/A INTRINSIC
Pfam:GKAP 343 682 1.3e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155016
AA Change: S686T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122896
Gene: ENSMUSG00000003279
AA Change: S686T

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 516 536 N/A INTRINSIC
low complexity region 552 569 N/A INTRINSIC
low complexity region 638 652 N/A INTRINSIC
Pfam:GKAP 660 992 2e-153 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,792,835 (GRCm39) probably null Het
Adgrf2 T A 17: 43,021,013 (GRCm39) T604S probably damaging Het
Akap8l T A 17: 32,540,905 (GRCm39) K533* probably null Het
Appbp2 T C 11: 85,125,502 (GRCm39) Y45C probably damaging Het
Arap2 T C 5: 62,828,322 (GRCm39) I950V possibly damaging Het
Arhgap31 T C 16: 38,422,697 (GRCm39) E1123G possibly damaging Het
Atp2c1 G T 9: 105,312,339 (GRCm39) N493K probably benign Het
Bcr T C 10: 74,960,943 (GRCm39) I458T probably damaging Het
Brd4 G A 17: 32,433,756 (GRCm39) T468I probably benign Het
Cdh23 T A 10: 60,146,940 (GRCm39) D2774V possibly damaging Het
Cfdp1 T C 8: 112,495,417 (GRCm39) Y267C probably damaging Het
Chd6 C A 2: 160,803,211 (GRCm39) A2156S probably benign Het
Dazap2 C A 15: 100,515,971 (GRCm39) P100T probably damaging Het
Disp1 T A 1: 182,869,208 (GRCm39) I1071F possibly damaging Het
Dst C T 1: 34,231,421 (GRCm39) R3183C possibly damaging Het
Enpp4 T C 17: 44,412,698 (GRCm39) N279D probably benign Het
Exoc3l T C 8: 106,016,593 (GRCm39) *740W probably null Het
Exoc5 A T 14: 49,252,937 (GRCm39) C625* probably null Het
Fam98b A T 2: 117,090,712 (GRCm39) N137Y possibly damaging Het
Fat4 T A 3: 38,945,776 (GRCm39) D1556E probably damaging Het
Fcer2a C A 8: 3,732,848 (GRCm39) V319L possibly damaging Het
Fer1l6 T C 15: 58,499,371 (GRCm39) V1247A probably benign Het
Fmo4 A G 1: 162,632,748 (GRCm39) V201A probably damaging Het
Fras1 G A 5: 96,762,763 (GRCm39) G755D probably benign Het
Grid2 T C 6: 63,886,029 (GRCm39) Y142H probably damaging Het
Hspg2 C T 4: 137,246,251 (GRCm39) R1010C probably damaging Het
Ibtk T C 9: 85,608,784 (GRCm39) Q376R probably damaging Het
Impdh2 T C 9: 108,442,155 (GRCm39) M414T probably damaging Het
Itm2c A G 1: 85,834,750 (GRCm39) T160A probably damaging Het
Kcna2 T A 3: 107,012,509 (GRCm39) D363E probably benign Het
Lama2 C T 10: 27,223,050 (GRCm39) C412Y probably damaging Het
Lims2 C G 18: 32,089,390 (GRCm39) T151S probably benign Het
Mier1 T C 4: 103,019,628 (GRCm39) S423P possibly damaging Het
Mrgpra3 A T 7: 47,239,180 (GRCm39) W249R probably benign Het
Mtor A G 4: 148,634,609 (GRCm39) H2410R probably benign Het
Mvp C T 7: 126,588,875 (GRCm39) A631T probably benign Het
Nepro T C 16: 44,556,192 (GRCm39) V450A possibly damaging Het
Ngrn T C 7: 79,914,269 (GRCm39) V140A probably damaging Het
Nobox T C 6: 43,282,942 (GRCm39) E231G probably benign Het
Or10al7 A T 17: 38,366,163 (GRCm39) I98N probably damaging Het
P3h2 T A 16: 25,923,971 (GRCm39) I155F probably benign Het
Pcdha3 C T 18: 37,081,144 (GRCm39) R629C probably damaging Het
Pramel24 A T 4: 143,453,416 (GRCm39) K175* probably null Het
Riok3 AGAAGCGG AG 18: 12,268,998 (GRCm39) probably benign Het
Rttn T C 18: 89,110,020 (GRCm39) I1675T probably benign Het
Sall2 C A 14: 52,551,260 (GRCm39) R643L probably damaging Het
Slc35f4 G T 14: 49,541,758 (GRCm39) T182N possibly damaging Het
Slc52a3 T A 2: 151,847,660 (GRCm39) I256N possibly damaging Het
Sox9 T C 11: 112,675,980 (GRCm39) S390P possibly damaging Het
Tango2 T C 16: 18,120,654 (GRCm39) probably benign Het
Tas1r1 T C 4: 152,116,614 (GRCm39) E340G possibly damaging Het
Tek G A 4: 94,718,207 (GRCm39) G524R probably damaging Het
Tmem260 A T 14: 48,742,761 (GRCm39) Y532F probably benign Het
Tsks C A 7: 44,607,353 (GRCm39) L559I probably damaging Het
Unc79 C A 12: 103,088,612 (GRCm39) L1702I probably damaging Het
Vmn1r14 T A 6: 57,211,133 (GRCm39) I237N probably damaging Het
Vmn2r17 G A 5: 109,600,832 (GRCm39) C710Y probably benign Het
Zfp119b G T 17: 56,245,926 (GRCm39) T420K possibly damaging Het
Zfp202 C T 9: 40,118,790 (GRCm39) R68* probably null Het
Zfp229 T A 17: 21,965,802 (GRCm39) S677R probably benign Het
Zfp462 C T 4: 55,008,411 (GRCm39) H126Y probably benign Het
Zfp52 C A 17: 21,780,459 (GRCm39) Y102* probably null Het
Zfp616 T A 11: 73,974,526 (GRCm39) M265K probably benign Het
Zfyve9 A T 4: 108,538,173 (GRCm39) I1031N probably damaging Het
Zmynd11 T C 13: 9,747,726 (GRCm39) Y203C probably damaging Het
Other mutations in Dlgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Dlgap1 APN 17 70,823,080 (GRCm39) missense probably benign 0.02
IGL01413:Dlgap1 APN 17 70,823,069 (GRCm39) missense probably benign 0.00
IGL01531:Dlgap1 APN 17 70,823,374 (GRCm39) missense probably damaging 1.00
IGL02226:Dlgap1 APN 17 70,823,029 (GRCm39) missense probably damaging 1.00
BB009:Dlgap1 UTSW 17 70,823,233 (GRCm39) missense probably damaging 1.00
BB019:Dlgap1 UTSW 17 70,823,233 (GRCm39) missense probably damaging 1.00
R0453:Dlgap1 UTSW 17 71,068,341 (GRCm39) missense probably benign 0.03
R0482:Dlgap1 UTSW 17 70,823,185 (GRCm39) missense probably benign 0.11
R0520:Dlgap1 UTSW 17 70,823,989 (GRCm39) nonsense probably null
R1951:Dlgap1 UTSW 17 71,068,306 (GRCm39) missense probably damaging 0.96
R2072:Dlgap1 UTSW 17 70,969,765 (GRCm39) missense probably damaging 0.99
R2076:Dlgap1 UTSW 17 71,093,826 (GRCm39) nonsense probably null
R3438:Dlgap1 UTSW 17 70,823,356 (GRCm39) missense probably damaging 0.97
R3743:Dlgap1 UTSW 17 71,025,221 (GRCm39) critical splice donor site probably null
R3881:Dlgap1 UTSW 17 71,093,810 (GRCm39) missense probably damaging 1.00
R3981:Dlgap1 UTSW 17 70,823,780 (GRCm39) missense probably damaging 1.00
R4043:Dlgap1 UTSW 17 71,068,075 (GRCm39) missense probably damaging 1.00
R4272:Dlgap1 UTSW 17 71,073,038 (GRCm39) missense probably benign
R4557:Dlgap1 UTSW 17 70,823,684 (GRCm39) missense probably benign 0.01
R4652:Dlgap1 UTSW 17 71,068,090 (GRCm39) missense probably damaging 1.00
R4771:Dlgap1 UTSW 17 70,900,375 (GRCm39) nonsense probably null
R5000:Dlgap1 UTSW 17 71,073,053 (GRCm39) missense probably damaging 1.00
R5004:Dlgap1 UTSW 17 71,025,222 (GRCm39) critical splice donor site probably null
R5291:Dlgap1 UTSW 17 71,025,205 (GRCm39) missense probably benign 0.03
R5304:Dlgap1 UTSW 17 71,122,202 (GRCm39) missense probably damaging 1.00
R5473:Dlgap1 UTSW 17 70,824,025 (GRCm39) intron probably benign
R5522:Dlgap1 UTSW 17 70,823,993 (GRCm39) critical splice donor site probably null
R5586:Dlgap1 UTSW 17 71,125,156 (GRCm39) missense probably damaging 1.00
R5742:Dlgap1 UTSW 17 71,025,194 (GRCm39) missense probably benign
R5802:Dlgap1 UTSW 17 71,073,086 (GRCm39) critical splice donor site probably null
R5850:Dlgap1 UTSW 17 71,094,087 (GRCm39) missense probably damaging 1.00
R5857:Dlgap1 UTSW 17 71,122,388 (GRCm39) intron probably benign
R5883:Dlgap1 UTSW 17 70,824,008 (GRCm39) intron probably benign
R6045:Dlgap1 UTSW 17 71,125,093 (GRCm39) missense probably damaging 1.00
R6336:Dlgap1 UTSW 17 71,122,284 (GRCm39) missense probably damaging 1.00
R6448:Dlgap1 UTSW 17 70,900,325 (GRCm39) missense possibly damaging 0.59
R6682:Dlgap1 UTSW 17 71,094,118 (GRCm39) missense probably damaging 1.00
R6795:Dlgap1 UTSW 17 71,125,069 (GRCm39) missense possibly damaging 0.48
R7147:Dlgap1 UTSW 17 70,969,753 (GRCm39) missense probably benign 0.00
R7187:Dlgap1 UTSW 17 70,823,093 (GRCm39) missense possibly damaging 0.93
R7382:Dlgap1 UTSW 17 71,094,169 (GRCm39) missense probably damaging 1.00
R7859:Dlgap1 UTSW 17 70,823,683 (GRCm39) missense probably benign
R7932:Dlgap1 UTSW 17 70,823,233 (GRCm39) missense probably damaging 1.00
R8477:Dlgap1 UTSW 17 70,823,967 (GRCm39) missense probably damaging 1.00
R8673:Dlgap1 UTSW 17 71,122,293 (GRCm39) missense probably damaging 1.00
R8866:Dlgap1 UTSW 17 70,823,435 (GRCm39) missense probably damaging 1.00
R8910:Dlgap1 UTSW 17 71,093,815 (GRCm39) missense probably damaging 1.00
R8997:Dlgap1 UTSW 17 70,823,528 (GRCm39) missense possibly damaging 0.63
R9012:Dlgap1 UTSW 17 70,823,182 (GRCm39) missense possibly damaging 0.94
R9035:Dlgap1 UTSW 17 70,823,855 (GRCm39) missense possibly damaging 0.73
R9067:Dlgap1 UTSW 17 71,116,186 (GRCm39) missense probably damaging 1.00
R9361:Dlgap1 UTSW 17 71,068,259 (GRCm39) missense probably damaging 1.00
R9464:Dlgap1 UTSW 17 70,823,964 (GRCm39) missense probably benign 0.11
R9550:Dlgap1 UTSW 17 71,093,902 (GRCm39) missense possibly damaging 0.61
R9564:Dlgap1 UTSW 17 70,964,458 (GRCm39) missense probably benign 0.02
R9565:Dlgap1 UTSW 17 70,964,458 (GRCm39) missense probably benign 0.02
T0975:Dlgap1 UTSW 17 70,823,950 (GRCm39) missense possibly damaging 0.86
Z1176:Dlgap1 UTSW 17 71,122,204 (GRCm39) missense probably damaging 1.00
Z1177:Dlgap1 UTSW 17 70,969,738 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCGCTGCTATCAGATGCAC -3'
(R):5'- GATGAATACTGTGCGGCCCTTC -3'

Sequencing Primer
(F):5'- CTGCTATCAGATGCACAAATGTGG -3'
(R):5'- TTCGCCACTCAGACGGGAG -3'
Posted On 2015-06-20