Incidental Mutation 'R4289:Arhgdib'
ID322331
Institutional Source Beutler Lab
Gene Symbol Arhgdib
Ensembl Gene ENSMUSG00000030220
Gene NameRho, GDP dissociation inhibitor (GDI) beta
SynonymsLy-GDI, D4, Gdid4
MMRRC Submission 041654-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4289 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location136923655-136941899 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136924158 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 191 (N191S)
Ref Sequence ENSEMBL: ENSMUSP00000107523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032343] [ENSMUST00000032344] [ENSMUST00000111891] [ENSMUST00000111892] [ENSMUST00000204627] [ENSMUST00000204934]
Predicted Effect probably benign
Transcript: ENSMUST00000032343
SMART Domains Protein: ENSMUSP00000032343
Gene: ENSMUSG00000030219

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
Pfam:Thioredoxin_6 64 251 2.8e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000032344
AA Change: N191S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000032344
Gene: ENSMUSG00000030220
AA Change: N191S

DomainStartEndE-ValueType
Pfam:Rho_GDI 1 197 4e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111891
AA Change: N191S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000107522
Gene: ENSMUSG00000030220
AA Change: N191S

DomainStartEndE-ValueType
Pfam:Rho_GDI 6 197 5.3e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111892
AA Change: N191S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000107523
Gene: ENSMUSG00000030220
AA Change: N191S

DomainStartEndE-ValueType
Pfam:Rho_GDI 1 197 4e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162755
Predicted Effect probably benign
Transcript: ENSMUST00000204627
SMART Domains Protein: ENSMUSP00000145191
Gene: ENSMUSG00000064330

DomainStartEndE-ValueType
Pfam:PDE6_gamma 2 74 1.5e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204934
SMART Domains Protein: ENSMUSP00000145103
Gene: ENSMUSG00000030220

DomainStartEndE-ValueType
Pfam:Rho_GDI 1 89 1.5e-38 PFAM
Meta Mutation Damage Score 0.0620 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the Rho guanine nucleotide dissociation inhibitor (GDI) family. This gene is expressed at high levels in hematopoietic cells. This protein is cytosolic, and dissociation of Rho from this protein is required for membrane association and activation of Rho by Guanine Nucleotide Exchange Factors (GEFs). C-terminal truncations of this gene product have been reported to promote metastasis. Multiple transcript variants and protein isoforms exist. [provided by RefSeq, Aug 2014]
PHENOTYPE: A homozygous null mutation results in mice that are viable and fertile. Immune responses are similar to controls in mice, but in vitro analysis demonstrated an increased B cell proliferative response upon lectin stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810022K09Rik T C 3: 14,609,654 M1V probably null Het
Actl6a C T 3: 32,712,114 T39M possibly damaging Het
Arhgef39 A G 4: 43,497,353 probably benign Het
Baz1a G A 12: 54,900,448 R1139C probably damaging Het
Cdhr5 A T 7: 141,272,839 I78N probably damaging Het
Cfap97 T A 8: 46,192,661 N525K probably benign Het
Cntn2 T A 1: 132,527,743 Y252F probably benign Het
Cyp3a57 G A 5: 145,349,397 G48S probably damaging Het
Cyp4v3 A C 8: 45,328,223 F73V possibly damaging Het
D3Ertd254e A G 3: 36,159,598 N27S possibly damaging Het
Ear10 T C 14: 43,922,947 D141G probably benign Het
Fbn2 T C 18: 58,035,339 I2309V probably damaging Het
Fcrl5 A G 3: 87,442,224 D102G probably benign Het
Fdxacb1 A T 9: 50,772,579 Q614L probably damaging Het
Gm10267 T C 18: 44,157,264 T59A probably damaging Het
Gm5581 C T 6: 131,167,556 noncoding transcript Het
Gm5592 G T 7: 41,158,912 probably benign Het
Gtf2a1l A G 17: 88,694,456 T200A probably damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ift122 T C 6: 115,923,891 C1057R probably damaging Het
Kirrel3 A T 9: 35,023,473 N73I probably benign Het
Kndc1 A G 7: 139,910,882 I433M probably benign Het
Mks1 T C 11: 87,856,704 probably benign Het
Mmp14 A T 14: 54,436,208 K110* probably null Het
Mms19 A G 19: 41,945,553 L938P probably damaging Het
Mrpl36 A T 13: 73,331,658 probably null Het
Mypn T C 10: 63,131,182 E905G probably damaging Het
Ncam1 G T 9: 49,557,172 T329N probably damaging Het
Nfkbie T C 17: 45,558,590 L157P probably damaging Het
Olfr1317 T A 2: 112,141,974 S10T probably benign Het
Olfr297 T A 7: 86,527,054 I99N probably damaging Het
Pappa C T 4: 65,155,863 A218V probably benign Het
Plekhg5 T C 4: 152,112,427 Y737H probably benign Het
Plod2 G A 9: 92,602,988 R514Q possibly damaging Het
Plxnb1 C T 9: 109,114,352 R1888W probably damaging Het
Prss45 A G 9: 110,840,929 T269A probably benign Het
Ptpn13 A G 5: 103,533,285 T784A probably damaging Het
Pycrl T C 15: 75,918,806 N68S probably benign Het
Rdh14 A T 12: 10,394,949 N267Y probably benign Het
Rph3a G A 5: 120,973,305 R71C probably damaging Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Spata13 T A 14: 60,691,074 V27E probably damaging Het
Tbc1d1 T A 5: 64,260,428 S312T probably damaging Het
Tcp11l2 T C 10: 84,605,073 probably null Het
Trdn C T 10: 33,464,582 S604L probably benign Het
Ttn T C 2: 76,810,398 T13669A probably benign Het
Tyw3 A T 3: 154,597,008 F30I probably damaging Het
Vmn1r227 G T 17: 20,735,830 noncoding transcript Het
Vmn2r74 C T 7: 85,957,354 M261I probably benign Het
Zfp217 C T 2: 170,114,787 G764S probably benign Het
Zfp748 T A 13: 67,541,083 H686L probably damaging Het
Other mutations in Arhgdib
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Arhgdib APN 6 136933624 missense probably damaging 1.00
IGL01712:Arhgdib APN 6 136924197 missense probably damaging 1.00
IGL02589:Arhgdib APN 6 136933578 intron probably benign
IGL02648:Arhgdib APN 6 136933649 missense probably damaging 1.00
IGL02682:Arhgdib APN 6 136924168 missense probably damaging 1.00
IGL03381:Arhgdib APN 6 136932316 missense probably benign 0.30
K7371:Arhgdib UTSW 6 136932299 splice site probably null
PIT4810001:Arhgdib UTSW 6 136924164 missense probably damaging 1.00
R0270:Arhgdib UTSW 6 136926734 missense probably damaging 1.00
R1755:Arhgdib UTSW 6 136929614 nonsense probably null
R5927:Arhgdib UTSW 6 136924138 missense probably damaging 1.00
R6364:Arhgdib UTSW 6 136932255 splice site probably null
R8010:Arhgdib UTSW 6 136926722 missense probably damaging 1.00
R8031:Arhgdib UTSW 6 136924276 missense probably benign 0.10
Z1088:Arhgdib UTSW 6 136933618 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGGGAACACTCTGAGAG -3'
(R):5'- CTTTCTTCCCAGTGGATAAAGC -3'

Sequencing Primer
(F):5'- AACATATTGGTGATGAAATGTGTGTG -3'
(R):5'- AAGCCACATTCATGGTTGGC -3'
Posted On2015-06-20