Mutagenetix > Incidental Mutation

Incidental Mutation 'R4289:Tcp11l2'

322346

Institutional Source

Beutler Lab

Gene Symbol

Tcp11l2

Ensembl Gene

ENSMUSG00000020034

Gene Name

t-complex 11 (mouse) like 2

Synonyms

E430026E19Rik

MMRRC Submission

041654-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.135) question?

Stock #

R4289 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84576626-84614359 bp(+) (GRCm38)

Type of Mutation

splice site (6 bp from exon)

DNA Base Change (assembly)

T to C at 84605073 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000020223 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020223]

AlphaFold

Q8K1H7

Predicted Effect

probably null
Transcript: ENSMUST00000020223

SMART Domains

Protein: ENSMUSP00000020223
Gene: ENSMUSG00000020034

Domain	Start	End	E-Value	Type
low complexity region	11	21	N/A	INTRINSIC
low complexity region	36	55	N/A	INTRINSIC
Pfam:Tcp11	77	497	5.8e-103	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160057

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (56/56)

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810022K09Rik	T	C	3: 14,609,654	M1V	probably null	Het
Actl6a	C	T	3: 32,712,114	T39M	possibly damaging	Het
Arhgdib	T	C	6: 136,924,158	N191S	probably benign	Het
Arhgef39	A	G	4: 43,497,353		probably benign	Het
Baz1a	G	A	12: 54,900,448	R1139C	probably damaging	Het
Cdhr5	A	T	7: 141,272,839	I78N	probably damaging	Het
Cfap97	T	A	8: 46,192,661	N525K	probably benign	Het
Cntn2	T	A	1: 132,527,743	Y252F	probably benign	Het
Cyp3a57	G	A	5: 145,349,397	G48S	probably damaging	Het
Cyp4v3	A	C	8: 45,328,223	F73V	possibly damaging	Het
D3Ertd254e	A	G	3: 36,159,598	N27S	possibly damaging	Het
Ear10	T	C	14: 43,922,947	D141G	probably benign	Het
Fbn2	T	C	18: 58,035,339	I2309V	probably damaging	Het
Fcrl5	A	G	3: 87,442,224	D102G	probably benign	Het
Fdxacb1	A	T	9: 50,772,579	Q614L	probably damaging	Het
Gm10267	T	C	18: 44,157,264	T59A	probably damaging	Het
Gm5581	C	T	6: 131,167,556		noncoding transcript	Het
Gm5592	G	T	7: 41,158,912		probably benign	Het
Gtf2a1l	A	G	17: 88,694,456	T200A	probably damaging	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Ift122	T	C	6: 115,923,891	C1057R	probably damaging	Het
Kirrel3	A	T	9: 35,023,473	N73I	probably benign	Het
Kndc1	A	G	7: 139,910,882	I433M	probably benign	Het
Mks1	T	C	11: 87,856,704		probably benign	Het
Mmp14	A	T	14: 54,436,208	K110*	probably null	Het
Mms19	A	G	19: 41,945,553	L938P	probably damaging	Het
Mrpl36	A	T	13: 73,331,658		probably null	Het
Mypn	T	C	10: 63,131,182	E905G	probably damaging	Het
Ncam1	G	T	9: 49,557,172	T329N	probably damaging	Het
Nfkbie	T	C	17: 45,558,590	L157P	probably damaging	Het
Olfr1317	T	A	2: 112,141,974	S10T	probably benign	Het
Olfr297	T	A	7: 86,527,054	I99N	probably damaging	Het
Pappa	C	T	4: 65,155,863	A218V	probably benign	Het
Plekhg5	T	C	4: 152,112,427	Y737H	probably benign	Het
Plod2	G	A	9: 92,602,988	R514Q	possibly damaging	Het
Plxnb1	C	T	9: 109,114,352	R1888W	probably damaging	Het
Prss45	A	G	9: 110,840,929	T269A	probably benign	Het
Ptpn13	A	G	5: 103,533,285	T784A	probably damaging	Het
Pycrl	T	C	15: 75,918,806	N68S	probably benign	Het
Rdh14	A	T	12: 10,394,949	N267Y	probably benign	Het
Rph3a	G	A	5: 120,973,305	R71C	probably damaging	Het
Sall2	C	A	14: 52,313,803	R643L	probably damaging	Het
Spata13	T	A	14: 60,691,074	V27E	probably damaging	Het
Tbc1d1	T	A	5: 64,260,428	S312T	probably damaging	Het
Trdn	C	T	10: 33,464,582	S604L	probably benign	Het
Ttn	T	C	2: 76,810,398	T13669A	probably benign	Het
Tyw3	A	T	3: 154,597,008	F30I	probably damaging	Het
Vmn1r227	G	T	17: 20,735,830		noncoding transcript	Het
Vmn2r74	C	T	7: 85,957,354	M261I	probably benign	Het
Zfp217	C	T	2: 170,114,787	G764S	probably benign	Het
Zfp748	T	A	13: 67,541,083	H686L	probably damaging	Het

Other mutations in Tcp11l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00725:Tcp11l2	APN	10	84594710	missense	possibly damaging	0.82
IGL00845:Tcp11l2	APN	10	84604983	missense	possibly damaging	0.95
IGL02375:Tcp11l2	APN	10	84605068	critical splice donor site	probably null
IGL02418:Tcp11l2	APN	10	84613606	nonsense	probably null
IGL03325:Tcp11l2	APN	10	84604900	missense	possibly damaging	0.76
R0031:Tcp11l2	UTSW	10	84591140	missense	probably damaging	0.98
R0591:Tcp11l2	UTSW	10	84604594	missense	probably benign	0.05
R1563:Tcp11l2	UTSW	10	84584944	missense	probably damaging	0.96
R1607:Tcp11l2	UTSW	10	84613487	missense	probably damaging	1.00
R1840:Tcp11l2	UTSW	10	84604599	missense	probably damaging	0.98
R2144:Tcp11l2	UTSW	10	84613499	missense	probably damaging	1.00
R2251:Tcp11l2	UTSW	10	84605069	critical splice donor site	probably null
R4639:Tcp11l2	UTSW	10	84584936	missense	probably damaging	1.00
R4844:Tcp11l2	UTSW	10	84613691	missense	probably benign	0.00
R4973:Tcp11l2	UTSW	10	84591163	missense	probably damaging	0.98
R5264:Tcp11l2	UTSW	10	84613660	missense	probably damaging	1.00
R5970:Tcp11l2	UTSW	10	84594797	splice site	probably benign
R6966:Tcp11l2	UTSW	10	84591269	missense	possibly damaging	0.79
R7250:Tcp11l2	UTSW	10	84587241	critical splice donor site	probably null
R7535:Tcp11l2	UTSW	10	84594659	missense	possibly damaging	0.67
R7565:Tcp11l2	UTSW	10	84587134	missense	probably damaging	1.00
R7619:Tcp11l2	UTSW	10	84594758	missense	probably damaging	1.00
R7774:Tcp11l2	UTSW	10	84604983	missense	possibly damaging	0.95
R8145:Tcp11l2	UTSW	10	84608616	missense	probably damaging	1.00
R8379:Tcp11l2	UTSW	10	84613605	missense	probably damaging	1.00
R8458:Tcp11l2	UTSW	10	84613532	nonsense	probably null
R8821:Tcp11l2	UTSW	10	84613658	missense	probably damaging	1.00
R8831:Tcp11l2	UTSW	10	84613658	missense	probably damaging	1.00
RF008:Tcp11l2	UTSW	10	84613524	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTTTCATGGCACTGGGCTTC -3'
(R):5'- TTCCAACAAGCTGCAGGAC -3'

Sequencing Primer
(F):5'- TGCTAGACACTCATGACAGATG -3'
(R):5'- TGCAGGACACTGTAGAAAGAG -3'

Posted On

2015-06-20