Incidental Mutation 'R4289:Baz1a'
ID322349
Institutional Source Beutler Lab
Gene Symbol Baz1a
Ensembl Gene ENSMUSG00000035021
Gene Namebromodomain adjacent to zinc finger domain 1A
SynonymsWcrf180, Acf1, Gtl5
MMRRC Submission 041654-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4289 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location54892989-55014348 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 54900448 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 1139 (R1139C)
Ref Sequence ENSEMBL: ENSMUSP00000039757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038926] [ENSMUST00000173433]
Predicted Effect probably damaging
Transcript: ENSMUST00000038926
AA Change: R1139C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039757
Gene: ENSMUSG00000035021
AA Change: R1139C

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 23 122 4.4e-36 PFAM
low complexity region 164 175 N/A INTRINSIC
coiled coil region 312 397 N/A INTRINSIC
Pfam:DDT 423 485 2.3e-14 PFAM
low complexity region 519 530 N/A INTRINSIC
Pfam:WHIM1 593 641 1.5e-8 PFAM
low complexity region 658 696 N/A INTRINSIC
low complexity region 725 738 N/A INTRINSIC
low complexity region 774 796 N/A INTRINSIC
low complexity region 861 873 N/A INTRINSIC
Pfam:WHIM3 894 932 2e-16 PFAM
low complexity region 1058 1073 N/A INTRINSIC
PHD 1151 1197 9.46e-15 SMART
RING 1152 1196 6.88e-1 SMART
low complexity region 1214 1257 N/A INTRINSIC
BROMO 1426 1534 2.18e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173433
AA Change: R1136C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133478
Gene: ENSMUSG00000035021
AA Change: R1136C

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 22 122 1.1e-37 PFAM
low complexity region 164 175 N/A INTRINSIC
coiled coil region 312 397 N/A INTRINSIC
DDT 422 487 1.54e-19 SMART
low complexity region 518 529 N/A INTRINSIC
Pfam:WHIM1 592 640 1.8e-8 PFAM
low complexity region 657 695 N/A INTRINSIC
low complexity region 722 735 N/A INTRINSIC
low complexity region 771 793 N/A INTRINSIC
low complexity region 858 870 N/A INTRINSIC
low complexity region 1055 1070 N/A INTRINSIC
PHD 1148 1194 9.46e-15 SMART
RING 1149 1193 6.88e-1 SMART
low complexity region 1211 1254 N/A INTRINSIC
BROMO 1423 1531 2.18e-31 SMART
Meta Mutation Damage Score 0.5001 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The BAZ1A gene encodes the accessory subunit of the ATP-dependent chromatin assembly factor (ACF), a member of the ISWI ('imitation switch') family of chromatin remodeling complexes (summarized by Racki et al., 2009 [PubMed 20033039]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and able to repair meiotic double-strand breaks but exhibit teratospermia, oligospermia, asthenospermia, and male infertility due to impaired spermiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810022K09Rik T C 3: 14,609,654 M1V probably null Het
Actl6a C T 3: 32,712,114 T39M possibly damaging Het
Arhgdib T C 6: 136,924,158 N191S probably benign Het
Arhgef39 A G 4: 43,497,353 probably benign Het
Cdhr5 A T 7: 141,272,839 I78N probably damaging Het
Cfap97 T A 8: 46,192,661 N525K probably benign Het
Cntn2 T A 1: 132,527,743 Y252F probably benign Het
Cyp3a57 G A 5: 145,349,397 G48S probably damaging Het
Cyp4v3 A C 8: 45,328,223 F73V possibly damaging Het
D3Ertd254e A G 3: 36,159,598 N27S possibly damaging Het
Ear10 T C 14: 43,922,947 D141G probably benign Het
Fbn2 T C 18: 58,035,339 I2309V probably damaging Het
Fcrl5 A G 3: 87,442,224 D102G probably benign Het
Fdxacb1 A T 9: 50,772,579 Q614L probably damaging Het
Gm10267 T C 18: 44,157,264 T59A probably damaging Het
Gm5581 C T 6: 131,167,556 noncoding transcript Het
Gm5592 G T 7: 41,158,912 probably benign Het
Gtf2a1l A G 17: 88,694,456 T200A probably damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ift122 T C 6: 115,923,891 C1057R probably damaging Het
Kirrel3 A T 9: 35,023,473 N73I probably benign Het
Kndc1 A G 7: 139,910,882 I433M probably benign Het
Mks1 T C 11: 87,856,704 probably benign Het
Mmp14 A T 14: 54,436,208 K110* probably null Het
Mms19 A G 19: 41,945,553 L938P probably damaging Het
Mrpl36 A T 13: 73,331,658 probably null Het
Mypn T C 10: 63,131,182 E905G probably damaging Het
Ncam1 G T 9: 49,557,172 T329N probably damaging Het
Nfkbie T C 17: 45,558,590 L157P probably damaging Het
Olfr1317 T A 2: 112,141,974 S10T probably benign Het
Olfr297 T A 7: 86,527,054 I99N probably damaging Het
Pappa C T 4: 65,155,863 A218V probably benign Het
Plekhg5 T C 4: 152,112,427 Y737H probably benign Het
Plod2 G A 9: 92,602,988 R514Q possibly damaging Het
Plxnb1 C T 9: 109,114,352 R1888W probably damaging Het
Prss45 A G 9: 110,840,929 T269A probably benign Het
Ptpn13 A G 5: 103,533,285 T784A probably damaging Het
Pycrl T C 15: 75,918,806 N68S probably benign Het
Rdh14 A T 12: 10,394,949 N267Y probably benign Het
Rph3a G A 5: 120,973,305 R71C probably damaging Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Spata13 T A 14: 60,691,074 V27E probably damaging Het
Tbc1d1 T A 5: 64,260,428 S312T probably damaging Het
Tcp11l2 T C 10: 84,605,073 probably null Het
Trdn C T 10: 33,464,582 S604L probably benign Het
Ttn T C 2: 76,810,398 T13669A probably benign Het
Tyw3 A T 3: 154,597,008 F30I probably damaging Het
Vmn1r227 G T 17: 20,735,830 noncoding transcript Het
Vmn2r74 C T 7: 85,957,354 M261I probably benign Het
Zfp217 C T 2: 170,114,787 G764S probably benign Het
Zfp748 T A 13: 67,541,083 H686L probably damaging Het
Other mutations in Baz1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Baz1a APN 12 54916731 missense probably benign
IGL01138:Baz1a APN 12 54930325 missense probably damaging 1.00
IGL01298:Baz1a APN 12 54954809 missense probably damaging 1.00
IGL02639:Baz1a APN 12 54896025 splice site probably benign
IGL02995:Baz1a APN 12 54900447 missense probably damaging 1.00
IGL03001:Baz1a APN 12 54923111 missense possibly damaging 0.50
IGL03104:Baz1a APN 12 54894958 missense probably damaging 1.00
IGL03135:Baz1a APN 12 54929590 missense probably damaging 1.00
IGL03151:Baz1a APN 12 54909149 critical splice acceptor site probably null
IGL03235:Baz1a APN 12 54898535 missense probably damaging 1.00
IGL03240:Baz1a APN 12 54927567 nonsense probably null
Bezos UTSW 12 54895031 nonsense probably null
Flavia UTSW 12 54975308 missense probably damaging 1.00
gumdrops UTSW 12 54900448 missense probably damaging 1.00
Kilter UTSW 12 54900532 missense probably damaging 0.99
Kisses UTSW 12 54975137 missense probably damaging 1.00
Smootch UTSW 12 54911385 missense probably damaging 1.00
PIT4458001:Baz1a UTSW 12 54930310 missense probably benign 0.03
R0127:Baz1a UTSW 12 54898706 missense possibly damaging 0.93
R0183:Baz1a UTSW 12 54911387 missense probably damaging 1.00
R0393:Baz1a UTSW 12 54918436 critical splice donor site probably null
R0532:Baz1a UTSW 12 54934820 missense possibly damaging 0.55
R0614:Baz1a UTSW 12 54941519 nonsense probably null
R0626:Baz1a UTSW 12 54975270 missense probably damaging 0.99
R0654:Baz1a UTSW 12 54911397 missense probably benign 0.01
R0782:Baz1a UTSW 12 54894488 missense probably damaging 1.00
R0826:Baz1a UTSW 12 54930312 nonsense probably null
R0855:Baz1a UTSW 12 54900563 splice site probably benign
R0927:Baz1a UTSW 12 54894988 missense probably damaging 1.00
R0941:Baz1a UTSW 12 54898431 missense probably benign 0.00
R1079:Baz1a UTSW 12 54895000 missense possibly damaging 0.91
R1157:Baz1a UTSW 12 54929564 missense probably damaging 1.00
R1647:Baz1a UTSW 12 54975198 missense probably damaging 1.00
R1731:Baz1a UTSW 12 54918545 missense possibly damaging 0.83
R1739:Baz1a UTSW 12 54898788 nonsense probably null
R1762:Baz1a UTSW 12 54909020 missense probably damaging 1.00
R1770:Baz1a UTSW 12 54898508 missense probably damaging 1.00
R1968:Baz1a UTSW 12 54900337 missense possibly damaging 0.91
R2037:Baz1a UTSW 12 54929646 missense probably damaging 1.00
R2111:Baz1a UTSW 12 54911385 missense probably damaging 1.00
R2215:Baz1a UTSW 12 54975369 nonsense probably null
R2282:Baz1a UTSW 12 54916812 nonsense probably null
R2875:Baz1a UTSW 12 54923119 missense probably damaging 1.00
R2890:Baz1a UTSW 12 54898517 missense probably benign
R2971:Baz1a UTSW 12 54923439 missense probably damaging 1.00
R3404:Baz1a UTSW 12 54916989 missense probably benign 0.00
R3419:Baz1a UTSW 12 54946899 missense probably benign 0.05
R3699:Baz1a UTSW 12 54917046 missense probably benign 0.09
R3899:Baz1a UTSW 12 54934804 missense probably benign 0.01
R3927:Baz1a UTSW 12 54921143 missense possibly damaging 0.68
R4050:Baz1a UTSW 12 54929619 missense probably benign 0.00
R4072:Baz1a UTSW 12 54941560 missense probably benign 0.18
R4196:Baz1a UTSW 12 54911415 missense probably damaging 1.00
R4455:Baz1a UTSW 12 54911368 missense probably benign 0.26
R4583:Baz1a UTSW 12 54922540 missense probably damaging 0.99
R4622:Baz1a UTSW 12 54941515 missense probably benign 0.00
R4807:Baz1a UTSW 12 54898482 missense probably benign 0.28
R4998:Baz1a UTSW 12 54975137 missense probably damaging 1.00
R5239:Baz1a UTSW 12 54898344 missense probably damaging 0.99
R5379:Baz1a UTSW 12 54894348 missense probably damaging 1.00
R5408:Baz1a UTSW 12 54923050 missense probably damaging 1.00
R5678:Baz1a UTSW 12 54900532 missense probably damaging 0.99
R5810:Baz1a UTSW 12 54927715 intron probably benign
R6092:Baz1a UTSW 12 54909083 missense possibly damaging 0.88
R6317:Baz1a UTSW 12 54954800 missense possibly damaging 0.92
R6332:Baz1a UTSW 12 54918554 missense probably benign 0.01
R6803:Baz1a UTSW 12 54941555 missense probably null 0.99
R7185:Baz1a UTSW 12 54975308 missense probably damaging 1.00
R7248:Baz1a UTSW 12 54900508 missense probably damaging 1.00
R7392:Baz1a UTSW 12 54898765 missense probably damaging 1.00
R8009:Baz1a UTSW 12 54895031 nonsense probably null
R8025:Baz1a UTSW 12 54909136 missense probably benign 0.34
R8392:Baz1a UTSW 12 54923123 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTCCATCAGGAACAGCC -3'
(R):5'- AATTCTAGTAGACATTTGCCTCTGC -3'

Sequencing Primer
(F):5'- GTCAAAATCTTAATGTCAATGTGCCC -3'
(R):5'- AGACATTTGCCTCTGCCCAGG -3'
Posted On2015-06-20