Incidental Mutation 'R4289:Mmp14'
ID322354
Institutional Source Beutler Lab
Gene Symbol Mmp14
Ensembl Gene ENSMUSG00000000957
Gene Namematrix metallopeptidase 14 (membrane-inserted)
Synonymssabe, Membrane type 1-MMP, MT1-MMP
MMRRC Submission 041654-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock #R4289 (G1)
Quality Score208
Status Validated
Chromosome14
Chromosomal Location54431612-54445364 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 54436208 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 110 (K110*)
Ref Sequence ENSEMBL: ENSMUSP00000153679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089688] [ENSMUST00000196155] [ENSMUST00000197874] [ENSMUST00000225641]
Predicted Effect probably null
Transcript: ENSMUST00000089688
AA Change: K110*
SMART Domains Protein: ENSMUSP00000087119
Gene: ENSMUSG00000000957
AA Change: K110*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:PG_binding_1 36 88 2.1e-12 PFAM
ZnMc 115 285 6.01e-58 SMART
HX 323 366 3.97e-9 SMART
HX 368 412 1.42e-10 SMART
HX 415 461 4.45e-12 SMART
HX 463 508 1.61e-9 SMART
Pfam:DUF3377 512 582 2.2e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000196155
Predicted Effect probably benign
Transcript: ENSMUST00000197874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198679
Predicted Effect probably null
Transcript: ENSMUST00000225641
AA Change: K110*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226710
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. Mice lacking the encoded protein exhibit craniofacial dysmorphism, arthritis, osteopenia, dwarfism, and fibrosis of soft tissues. [provided by RefSeq, Feb 2016]
PHENOTYPE: Nullizygous mutations may lead to postnatal or premature death, craniofacial anomalies, skeletal dysplasia, low body weight, reduced bone formation and chondrocyte proliferation, arthritis, and fibrosis as well as defects in angiogenesis and lung, tooth,kidney, and submaxillary gland development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810022K09Rik T C 3: 14,609,654 M1V probably null Het
Actl6a C T 3: 32,712,114 T39M possibly damaging Het
Arhgdib T C 6: 136,924,158 N191S probably benign Het
Arhgef39 A G 4: 43,497,353 probably benign Het
Baz1a G A 12: 54,900,448 R1139C probably damaging Het
Cdhr5 A T 7: 141,272,839 I78N probably damaging Het
Cfap97 T A 8: 46,192,661 N525K probably benign Het
Cntn2 T A 1: 132,527,743 Y252F probably benign Het
Cyp3a57 G A 5: 145,349,397 G48S probably damaging Het
Cyp4v3 A C 8: 45,328,223 F73V possibly damaging Het
D3Ertd254e A G 3: 36,159,598 N27S possibly damaging Het
Ear10 T C 14: 43,922,947 D141G probably benign Het
Fbn2 T C 18: 58,035,339 I2309V probably damaging Het
Fcrl5 A G 3: 87,442,224 D102G probably benign Het
Fdxacb1 A T 9: 50,772,579 Q614L probably damaging Het
Gm10267 T C 18: 44,157,264 T59A probably damaging Het
Gm5581 C T 6: 131,167,556 noncoding transcript Het
Gm5592 G T 7: 41,158,912 probably benign Het
Gtf2a1l A G 17: 88,694,456 T200A probably damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ift122 T C 6: 115,923,891 C1057R probably damaging Het
Kirrel3 A T 9: 35,023,473 N73I probably benign Het
Kndc1 A G 7: 139,910,882 I433M probably benign Het
Mks1 T C 11: 87,856,704 probably benign Het
Mms19 A G 19: 41,945,553 L938P probably damaging Het
Mrpl36 A T 13: 73,331,658 probably null Het
Mypn T C 10: 63,131,182 E905G probably damaging Het
Ncam1 G T 9: 49,557,172 T329N probably damaging Het
Nfkbie T C 17: 45,558,590 L157P probably damaging Het
Olfr1317 T A 2: 112,141,974 S10T probably benign Het
Olfr297 T A 7: 86,527,054 I99N probably damaging Het
Pappa C T 4: 65,155,863 A218V probably benign Het
Plekhg5 T C 4: 152,112,427 Y737H probably benign Het
Plod2 G A 9: 92,602,988 R514Q possibly damaging Het
Plxnb1 C T 9: 109,114,352 R1888W probably damaging Het
Prss45 A G 9: 110,840,929 T269A probably benign Het
Ptpn13 A G 5: 103,533,285 T784A probably damaging Het
Pycrl T C 15: 75,918,806 N68S probably benign Het
Rdh14 A T 12: 10,394,949 N267Y probably benign Het
Rph3a G A 5: 120,973,305 R71C probably damaging Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Spata13 T A 14: 60,691,074 V27E probably damaging Het
Tbc1d1 T A 5: 64,260,428 S312T probably damaging Het
Tcp11l2 T C 10: 84,605,073 probably null Het
Trdn C T 10: 33,464,582 S604L probably benign Het
Ttn T C 2: 76,810,398 T13669A probably benign Het
Tyw3 A T 3: 154,597,008 F30I probably damaging Het
Vmn1r227 G T 17: 20,735,830 noncoding transcript Het
Vmn2r74 C T 7: 85,957,354 M261I probably benign Het
Zfp217 C T 2: 170,114,787 G764S probably benign Het
Zfp748 T A 13: 67,541,083 H686L probably damaging Het
Other mutations in Mmp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Mmp14 APN 14 54435790 missense possibly damaging 0.60
IGL01937:Mmp14 APN 14 54437596 splice site probably benign
IGL02565:Mmp14 APN 14 54440557 missense probably benign 0.02
cartoon UTSW 14 54439999 missense probably damaging 0.96
IGL03134:Mmp14 UTSW 14 54439106 missense probably damaging 1.00
R0053:Mmp14 UTSW 14 54438652 splice site probably benign
R0053:Mmp14 UTSW 14 54438652 splice site probably benign
R0538:Mmp14 UTSW 14 54438709 missense possibly damaging 0.47
R0612:Mmp14 UTSW 14 54440434 missense probably damaging 1.00
R2352:Mmp14 UTSW 14 54440545 missense probably benign 0.30
R3700:Mmp14 UTSW 14 54431932 unclassified probably benign
R4888:Mmp14 UTSW 14 54436205 missense probably damaging 0.98
R5068:Mmp14 UTSW 14 54439113 missense probably damaging 1.00
R5069:Mmp14 UTSW 14 54439113 missense probably damaging 1.00
R5070:Mmp14 UTSW 14 54439113 missense probably damaging 1.00
R5216:Mmp14 UTSW 14 54437663 missense possibly damaging 0.82
R5607:Mmp14 UTSW 14 54439412 missense probably damaging 1.00
R6053:Mmp14 UTSW 14 54435890 missense probably benign 0.39
R6477:Mmp14 UTSW 14 54437658 missense probably damaging 1.00
R7153:Mmp14 UTSW 14 54436251 missense possibly damaging 0.93
R7212:Mmp14 UTSW 14 54435879 missense probably damaging 1.00
R7555:Mmp14 UTSW 14 54437742 missense possibly damaging 0.96
X0064:Mmp14 UTSW 14 54431946 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCCACTGACCGTGCTGAATAC -3'
(R):5'- TGGCTGTACTTCTCTGCAAG -3'

Sequencing Primer
(F):5'- GTGCTGAATACCAAACATGCTTC -3'
(R):5'- GCTGTACTTCTCTGCAAGATTAGAGC -3'
Posted On2015-06-20