Incidental Mutation 'R4300:Prc1'
ID322375
Institutional Source Beutler Lab
Gene Symbol Prc1
Ensembl Gene ENSMUSG00000038943
Gene Nameprotein regulator of cytokinesis 1
SynonymsD7Ertd348e
MMRRC Submission 041657-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4300 (G1)
Quality Score208
Status Validated
Chromosome7
Chromosomal Location80294450-80316259 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 80311216 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000047362] [ENSMUST00000047558] [ENSMUST00000163812] [ENSMUST00000172781] [ENSMUST00000173824] [ENSMUST00000174172] [ENSMUST00000174199]
Predicted Effect probably benign
Transcript: ENSMUST00000047362
SMART Domains Protein: ENSMUSP00000048043
Gene: ENSMUSG00000038930

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
Pfam:RCC1 179 228 2.9e-17 PFAM
Pfam:RCC1_2 215 244 1.3e-10 PFAM
Pfam:RCC1 231 316 7.8e-9 PFAM
Pfam:RCC1_2 303 332 3.3e-10 PFAM
Pfam:RCC1 319 370 4.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047558
SMART Domains Protein: ENSMUSP00000043379
Gene: ENSMUSG00000038943

DomainStartEndE-ValueType
internal_repeat_1 22 36 1.45e-5 PROSPERO
Pfam:MAP65_ASE1 37 602 5.3e-172 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130888
Predicted Effect probably benign
Transcript: ENSMUST00000163812
SMART Domains Protein: ENSMUSP00000129675
Gene: ENSMUSG00000038943

DomainStartEndE-ValueType
internal_repeat_1 22 36 1.51e-5 PROSPERO
Pfam:MAP65_ASE1 37 605 1.9e-173 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172781
SMART Domains Protein: ENSMUSP00000133618
Gene: ENSMUSG00000038943

DomainStartEndE-ValueType
Pfam:MAP65_ASE1 1 150 2.1e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172911
Predicted Effect probably benign
Transcript: ENSMUST00000173170
SMART Domains Protein: ENSMUSP00000133817
Gene: ENSMUSG00000038943

DomainStartEndE-ValueType
Pfam:MAP65_ASE1 1 189 2.1e-64 PFAM
Pfam:MAP65_ASE1 187 235 1.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173824
SMART Domains Protein: ENSMUSP00000133910
Gene: ENSMUSG00000038943

DomainStartEndE-ValueType
internal_repeat_1 22 36 8.71e-6 PROSPERO
Pfam:MAP65_ASE1 37 565 6e-168 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174051
SMART Domains Protein: ENSMUSP00000134262
Gene: ENSMUSG00000038943

DomainStartEndE-ValueType
Pfam:MAP65_ASE1 1 244 1.9e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174111
Predicted Effect probably benign
Transcript: ENSMUST00000174172
SMART Domains Protein: ENSMUSP00000133387
Gene: ENSMUSG00000038943

DomainStartEndE-ValueType
Pfam:MAP65_ASE1 34 615 2.9e-167 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174199
SMART Domains Protein: ENSMUSP00000133295
Gene: ENSMUSG00000038943

DomainStartEndE-ValueType
Pfam:MAP65_ASE1 7 524 8.1e-158 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174599
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in cytokinesis. The protein is present at high levels during the S and G2/M phases of mitosis but its levels drop dramatically when the cell exits mitosis and enters the G1 phase. It is located in the nucleus during interphase, becomes associated with mitotic spindles in a highly dynamic manner during mitosis, and localizes to the cell mid-body during cytokinesis. This protein has been shown to be a substrate of several cyclin-dependent kinases (CDKs). It is necessary for polarizing parallel microtubules and concentrating the factors responsible for contractile ring assembly. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik A G 18: 12,188,862 N513D probably benign Het
4930503B20Rik T A 3: 146,650,920 R78* probably null Het
A2m G A 6: 121,673,475 V1181I probably benign Het
Cacna1b T C 2: 24,635,239 S1639G probably damaging Het
Ccs T C 19: 4,834,257 T56A probably benign Het
Cd177 T C 7: 24,750,420 I547V possibly damaging Het
Ckmt2 C A 13: 91,863,338 probably null Het
Cyth1 A G 11: 118,183,894 F180L probably damaging Het
Dip2c A G 13: 9,610,711 I840M probably damaging Het
Gm37150 G A 9: 72,385,476 noncoding transcript Het
Herc1 A G 9: 66,489,406 D4255G probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnn4 G T 7: 24,377,604 V193L probably benign Het
Lrrc8d G A 5: 105,813,740 R672Q probably damaging Het
Mboat2 A G 12: 24,959,083 N463D probably benign Het
Mtfr1 T A 3: 19,215,457 probably null Het
Olfr192 T C 16: 59,098,278 Y238C unknown Het
Olfr981 A C 9: 40,023,139 I249L probably benign Het
Pcnt G C 10: 76,367,391 R2626G probably benign Het
Pik3cg A G 12: 32,176,672 I1072T probably damaging Het
Psph G T 5: 129,787,465 probably null Het
Rfx4 T C 10: 84,905,102 Y601H probably damaging Het
Setd5 T G 6: 113,150,162 V1249G probably damaging Het
Sirpb1b A T 3: 15,548,761 I87K probably damaging Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Spata31 A T 13: 64,919,761 H79L probably benign Het
Srbd1 C A 17: 85,985,204 R979L probably damaging Het
Stox2 A T 8: 47,193,992 Y208* probably null Het
Sun1 A T 5: 139,227,594 probably benign Het
Tfap4 T C 16: 4,551,360 D132G probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tubgcp3 G T 8: 12,657,600 P130T probably damaging Het
Txlnb A G 10: 17,827,925 E277G probably damaging Het
Other mutations in Prc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Prc1 APN 7 80307696 critical splice donor site probably null
IGL02342:Prc1 APN 7 80309442 missense probably damaging 1.00
IGL03058:Prc1 APN 7 80301125 missense probably benign 0.05
R0026:Prc1 UTSW 7 80311061 unclassified probably benign
R0315:Prc1 UTSW 7 80313536 missense probably damaging 0.99
R0453:Prc1 UTSW 7 80313102 missense probably damaging 1.00
R2101:Prc1 UTSW 7 80312284 missense probably benign 0.38
R2857:Prc1 UTSW 7 80312221 missense probably damaging 0.99
R4237:Prc1 UTSW 7 80311216 unclassified probably benign
R4238:Prc1 UTSW 7 80311216 unclassified probably benign
R4240:Prc1 UTSW 7 80311216 unclassified probably benign
R4745:Prc1 UTSW 7 80313163 missense probably benign 0.10
R5227:Prc1 UTSW 7 80313179 missense probably damaging 1.00
R5574:Prc1 UTSW 7 80294542 unclassified probably benign
R6174:Prc1 UTSW 7 80304796 missense probably benign 0.02
R6269:Prc1 UTSW 7 80309427 missense probably damaging 0.99
R7060:Prc1 UTSW 7 80304373 missense probably benign 0.00
R7201:Prc1 UTSW 7 80311089 missense possibly damaging 0.65
R7266:Prc1 UTSW 7 80307657 missense possibly damaging 0.78
R7491:Prc1 UTSW 7 80309491 splice site probably null
R7498:Prc1 UTSW 7 80313150 missense possibly damaging 0.83
R7528:Prc1 UTSW 7 80300435 critical splice donor site probably null
R7911:Prc1 UTSW 7 80304372 missense probably benign
R7992:Prc1 UTSW 7 80304372 missense probably benign
Z1176:Prc1 UTSW 7 80306485 missense not run
Predicted Primers PCR Primer
(F):5'- TCCTGCTGTCTTAATGGGGC -3'
(R):5'- TTGCCACAGTACTATGAACTTCTG -3'

Sequencing Primer
(F):5'- GCTGTCATTGGTCCATACAGCAAC -3'
(R):5'- TGAATGTTGCTTTTAGTAGCCAC -3'
Posted On2015-06-20