Incidental Mutation 'R4300:Cyth1'
ID322386
Institutional Source Beutler Lab
Gene Symbol Cyth1
Ensembl Gene ENSMUSG00000017132
Gene Namecytohesin 1
SynonymsCTH-1, Pscd1, CLM1
MMRRC Submission 041657-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R4300 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location118132019-118248592 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118183894 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 180 (F180L)
Ref Sequence ENSEMBL: ENSMUSP00000101912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017276] [ENSMUST00000100181] [ENSMUST00000106302] [ENSMUST00000106305] [ENSMUST00000151165]
Predicted Effect probably damaging
Transcript: ENSMUST00000017276
AA Change: F180L

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000017276
Gene: ENSMUSG00000017132
AA Change: F180L

DomainStartEndE-ValueType
Sec7 59 244 1.38e-108 SMART
PH 261 378 4.8e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100181
AA Change: F194L

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097756
Gene: ENSMUSG00000017132
AA Change: F194L

DomainStartEndE-ValueType
Sec7 73 258 1.38e-108 SMART
PH 275 392 1.65e-23 SMART
low complexity region 402 425 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106302
AA Change: F182L

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101909
Gene: ENSMUSG00000017132
AA Change: F182L

DomainStartEndE-ValueType
Sec7 61 246 1.38e-108 SMART
PH 263 381 4.18e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106305
AA Change: F180L

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101912
Gene: ENSMUSG00000017132
AA Change: F180L

DomainStartEndE-ValueType
Sec7 59 244 1.38e-108 SMART
PH 261 379 4.18e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141243
Predicted Effect probably benign
Transcript: ENSMUST00000151165
SMART Domains Protein: ENSMUSP00000114792
Gene: ENSMUSG00000017132

DomainStartEndE-ValueType
SCOP:d1pbv__ 55 99 4e-15 SMART
PDB:1BC9|A 60 99 9e-21 PDB
Blast:Sec7 61 99 1e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157494
Meta Mutation Damage Score 0.7359 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PSCD family. Members of this family have identical structural organization that consists of an N-terminal coiled-coil motif, a central Sec7 domain, and a C-terminal pleckstrin homology (PH) domain. The coiled-coil motif is involved in homodimerization, the Sec7 domain contains guanine-nucleotide exchange protein activity, and the PH domain interacts with phospholipids and is responsible for association of PSCDs with membranes. Members of this family appear to mediate the regulation of protein sorting and membrane trafficking. This gene is highly expressed in natural killer and peripheral T cells, and regulates the adhesiveness of integrins at the plasma membrane of lymphocytes. A pseudogene of this gene has been defined on the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit normal brain morphology and long term potentiation. Mice homozygous for a knock-out allele exhibit decreased myelin sheath thickness due to hypomyelination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik A G 18: 12,188,862 N513D probably benign Het
4930503B20Rik T A 3: 146,650,920 R78* probably null Het
A2m G A 6: 121,673,475 V1181I probably benign Het
Cacna1b T C 2: 24,635,239 S1639G probably damaging Het
Ccs T C 19: 4,834,257 T56A probably benign Het
Cd177 T C 7: 24,750,420 I547V possibly damaging Het
Ckmt2 C A 13: 91,863,338 probably null Het
Dip2c A G 13: 9,610,711 I840M probably damaging Het
Gm37150 G A 9: 72,385,476 noncoding transcript Het
Herc1 A G 9: 66,489,406 D4255G probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnn4 G T 7: 24,377,604 V193L probably benign Het
Lrrc8d G A 5: 105,813,740 R672Q probably damaging Het
Mboat2 A G 12: 24,959,083 N463D probably benign Het
Mtfr1 T A 3: 19,215,457 probably null Het
Olfr192 T C 16: 59,098,278 Y238C unknown Het
Olfr981 A C 9: 40,023,139 I249L probably benign Het
Pcnt G C 10: 76,367,391 R2626G probably benign Het
Pik3cg A G 12: 32,176,672 I1072T probably damaging Het
Prc1 G A 7: 80,311,216 probably benign Het
Psph G T 5: 129,787,465 probably null Het
Rfx4 T C 10: 84,905,102 Y601H probably damaging Het
Setd5 T G 6: 113,150,162 V1249G probably damaging Het
Sirpb1b A T 3: 15,548,761 I87K probably damaging Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Spata31 A T 13: 64,919,761 H79L probably benign Het
Srbd1 C A 17: 85,985,204 R979L probably damaging Het
Stox2 A T 8: 47,193,992 Y208* probably null Het
Sun1 A T 5: 139,227,594 probably benign Het
Tfap4 T C 16: 4,551,360 D132G probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tubgcp3 G T 8: 12,657,600 P130T probably damaging Het
Txlnb A G 10: 17,827,925 E277G probably damaging Het
Other mutations in Cyth1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Cyth1 APN 11 118193613 critical splice donor site probably null
IGL02047:Cyth1 APN 11 118169132 missense probably damaging 1.00
IGL02658:Cyth1 APN 11 118182246 missense probably damaging 0.99
IGL02826:Cyth1 APN 11 118185481 missense possibly damaging 0.89
Mucilage UTSW 11 118170860 missense probably damaging 1.00
Stuck UTSW 11 118185759 critical splice donor site probably null
tarred UTSW 11 118183923 nonsense probably null
R0109:Cyth1 UTSW 11 118182306 missense probably damaging 0.98
R0109:Cyth1 UTSW 11 118182306 missense probably damaging 0.98
R0470:Cyth1 UTSW 11 118132248 unclassified probably benign
R1387:Cyth1 UTSW 11 118182346 unclassified probably benign
R1599:Cyth1 UTSW 11 118177221 missense probably damaging 0.99
R2098:Cyth1 UTSW 11 118193653 missense probably damaging 1.00
R2156:Cyth1 UTSW 11 118182808 missense probably damaging 1.00
R3546:Cyth1 UTSW 11 118192436 missense probably damaging 0.96
R4589:Cyth1 UTSW 11 118184985 missense possibly damaging 0.70
R4799:Cyth1 UTSW 11 118183942 missense probably damaging 1.00
R5165:Cyth1 UTSW 11 118169082 missense possibly damaging 0.82
R5524:Cyth1 UTSW 11 118182767 missense probably benign 0.27
R5834:Cyth1 UTSW 11 118192463 critical splice acceptor site probably null
R5933:Cyth1 UTSW 11 118185759 critical splice donor site probably null
R5960:Cyth1 UTSW 11 118132367 unclassified probably benign
R6609:Cyth1 UTSW 11 118170860 missense probably damaging 1.00
R7014:Cyth1 UTSW 11 118212651 missense probably benign
R7108:Cyth1 UTSW 11 118182913 missense probably damaging 0.99
R7237:Cyth1 UTSW 11 118185495 missense probably damaging 1.00
R7401:Cyth1 UTSW 11 118182251 missense possibly damaging 0.94
R7424:Cyth1 UTSW 11 118184009 splice site probably null
R7523:Cyth1 UTSW 11 118183923 nonsense probably null
R7574:Cyth1 UTSW 11 118182863 missense probably damaging 1.00
R7647:Cyth1 UTSW 11 118177288 missense probably benign 0.00
R7731:Cyth1 UTSW 11 118169053 missense possibly damaging 0.55
R7848:Cyth1 UTSW 11 118183923 nonsense probably null
R7849:Cyth1 UTSW 11 118183923 nonsense probably null
R7931:Cyth1 UTSW 11 118183923 nonsense probably null
R7932:Cyth1 UTSW 11 118183923 nonsense probably null
X0063:Cyth1 UTSW 11 118132329 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACATGAGGCAAGCACTCCTC -3'
(R):5'- TTAAGGCCACAGTGGTTACATTTG -3'

Sequencing Primer
(F):5'- TCCACTAAGCACACCAGGTGTAG -3'
(R):5'- GCCACAGTGGTTACATTTGCTTCTG -3'
Posted On2015-06-20