Mutagenetix > Incidental Mutations

Incidental Mutation 'R4300:Dip2c'

322389

Institutional Source

Beutler Lab

Gene Symbol

Dip2c

Ensembl Gene

ENSMUSG00000048264

Gene Name

disco interacting protein 2 homolog C

Synonyms

2900024P20Rik

MMRRC Submission

041657-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.448) question?

Stock #

R4300 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

9276528-9668928 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 9610711 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 840 (I840M)

Ref Sequence

ENSEMBL: ENSMUSP00000131238 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166299] [ENSMUST00000169960] [ENSMUST00000174552]

Predicted Effect

probably damaging
Transcript: ENSMUST00000166299
AA Change: I870M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000126827
Gene: ENSMUSG00000048264
AA Change: I870M

Domain	Start	End	E-Value	Type
DMAP_binding	7	120	3.55e-43	SMART
low complexity region	170	187	N/A	INTRINSIC
low complexity region	275	287	N/A	INTRINSIC
Pfam:AMP-binding	324	801	3.6e-23	PFAM
Pfam:AMP-binding	977	1451	1.5e-72	PFAM
low complexity region	1514	1526	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169960
AA Change: I840M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000131238
Gene: ENSMUSG00000048264
AA Change: I840M

Domain	Start	End	E-Value	Type
DMAP_binding	7	176	3.02e-37	SMART
low complexity region	226	243	N/A	INTRINSIC
low complexity region	331	343	N/A	INTRINSIC
Pfam:AMP-binding	380	637	5.9e-10	PFAM
SCOP:d1lci__	675	875	2e-8	SMART
Pfam:AMP-binding	947	1421	1.2e-56	PFAM
low complexity region	1484	1496	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000174552
AA Change: I869M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000133806
Gene: ENSMUSG00000048264
AA Change: I869M

Domain	Start	End	E-Value	Type
DMAP_binding	7	120	3.55e-43	SMART
low complexity region	170	187	N/A	INTRINSIC
low complexity region	275	287	N/A	INTRINSIC
Pfam:AMP-binding	324	800	2.7e-20	PFAM
Pfam:AMP-binding	976	1450	1.3e-56	PFAM
low complexity region	1513	1525	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000222280

Meta Mutation Damage Score

0.2904

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 family. The protein shares strong similarity with a Drosophila protein which interacts with the transcription factor disco and is expressed in the nervous system. [provided by RefSeq, Oct 2008]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	A	G	18: 12,188,862	N513D	probably benign	Het
4930503B20Rik	T	A	3: 146,650,920	R78*	probably null	Het
A2m	G	A	6: 121,673,475	V1181I	probably benign	Het
Cacna1b	T	C	2: 24,635,239	S1639G	probably damaging	Het
Ccs	T	C	19: 4,834,257	T56A	probably benign	Het
Cd177	T	C	7: 24,750,420	I547V	possibly damaging	Het
Ckmt2	C	A	13: 91,863,338		probably null	Het
Cyth1	A	G	11: 118,183,894	F180L	probably damaging	Het
Gm37150	G	A	9: 72,385,476		noncoding transcript	Het
Herc1	A	G	9: 66,489,406	D4255G	probably damaging	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Kcnn4	G	T	7: 24,377,604	V193L	probably benign	Het
Lrrc8d	G	A	5: 105,813,740	R672Q	probably damaging	Het
Mboat2	A	G	12: 24,959,083	N463D	probably benign	Het
Mtfr1	T	A	3: 19,215,457		probably null	Het
Olfr192	T	C	16: 59,098,278	Y238C	unknown	Het
Olfr981	A	C	9: 40,023,139	I249L	probably benign	Het
Pcnt	G	C	10: 76,367,391	R2626G	probably benign	Het
Pik3cg	A	G	12: 32,176,672	I1072T	probably damaging	Het
Prc1	G	A	7: 80,311,216		probably benign	Het
Psph	G	T	5: 129,787,465		probably null	Het
Rfx4	T	C	10: 84,905,102	Y601H	probably damaging	Het
Setd5	T	G	6: 113,150,162	V1249G	probably damaging	Het
Sirpb1b	A	T	3: 15,548,761	I87K	probably damaging	Het
Slc14a2	G	A	18: 78,207,068	R62C	probably damaging	Het
Spata31	A	T	13: 64,919,761	H79L	probably benign	Het
Srbd1	C	A	17: 85,985,204	R979L	probably damaging	Het
Stox2	A	T	8: 47,193,992	Y208*	probably null	Het
Sun1	A	T	5: 139,227,594		probably benign	Het
Tfap4	T	C	16: 4,551,360	D132G	probably damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Tubgcp3	G	T	8: 12,657,600	P130T	probably damaging	Het
Txlnb	A	G	10: 17,827,925	E277G	probably damaging	Het

Other mutations in Dip2c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Dip2c	APN	13	9493108	missense	probably damaging	0.97
IGL00426:Dip2c	APN	13	9606515	missense	probably damaging	1.00
IGL00503:Dip2c	APN	13	9567898	missense	probably damaging	1.00
IGL00586:Dip2c	APN	13	9610755	missense	probably damaging	1.00
IGL01306:Dip2c	APN	13	9575143	missense	possibly damaging	0.72
IGL01580:Dip2c	APN	13	9637088	splice site	probably null
IGL01985:Dip2c	APN	13	9553267	splice site	probably benign
IGL02060:Dip2c	APN	13	9622630	missense	probably damaging	0.98
IGL02122:Dip2c	APN	13	9506659	missense	possibly damaging	0.48
IGL02170:Dip2c	APN	13	9606335	missense	probably benign	0.03
IGL02211:Dip2c	APN	13	9610847	missense	probably damaging	1.00
IGL02755:Dip2c	APN	13	9550320	critical splice donor site	probably null
IGL02836:Dip2c	APN	13	9610790	missense	probably damaging	0.98
IGL02935:Dip2c	APN	13	9662146	missense	probably damaging	1.00
IGL03032:Dip2c	APN	13	9551778	missense	probably damaging	1.00
ANU23:Dip2c	UTSW	13	9575143	missense	possibly damaging	0.72
P0038:Dip2c	UTSW	13	9646982	missense	probably damaging	1.00
R0009:Dip2c	UTSW	13	9621903	missense	probably damaging	1.00
R0268:Dip2c	UTSW	13	9637150	missense	probably damaging	1.00
R0271:Dip2c	UTSW	13	9615775	missense	probably damaging	1.00
R0306:Dip2c	UTSW	13	9604599	missense	probably benign	0.09
R0415:Dip2c	UTSW	13	9568289	splice site	probably benign
R0519:Dip2c	UTSW	13	9563208	missense	probably damaging	1.00
R0557:Dip2c	UTSW	13	9553459	missense	possibly damaging	0.81
R0964:Dip2c	UTSW	13	9568663	missense	probably benign	0.43
R0973:Dip2c	UTSW	13	9576908	missense	probably damaging	0.99
R0973:Dip2c	UTSW	13	9576908	missense	probably damaging	0.99
R0974:Dip2c	UTSW	13	9576908	missense	probably damaging	0.99
R1101:Dip2c	UTSW	13	9634744	missense	probably damaging	1.00
R1171:Dip2c	UTSW	13	9493126	missense	possibly damaging	0.89
R1403:Dip2c	UTSW	13	9553264	splice site	probably null
R1403:Dip2c	UTSW	13	9553264	splice site	probably null
R1432:Dip2c	UTSW	13	9553304	missense	probably damaging	0.99
R1481:Dip2c	UTSW	13	9551866	critical splice donor site	probably null
R1588:Dip2c	UTSW	13	9665864	missense	probably damaging	1.00
R1721:Dip2c	UTSW	13	9659368	missense	probably damaging	1.00
R1726:Dip2c	UTSW	13	9575428	missense	probably damaging	1.00
R1867:Dip2c	UTSW	13	9621949	missense	possibly damaging	0.55
R1909:Dip2c	UTSW	13	9533350	missense	probably benign	0.00
R2013:Dip2c	UTSW	13	9567846	nonsense	probably null
R2022:Dip2c	UTSW	13	9551800	missense	probably damaging	1.00
R2517:Dip2c	UTSW	13	9609005	missense	probably damaging	1.00
R3746:Dip2c	UTSW	13	9601473	missense	probably damaging	1.00
R3794:Dip2c	UTSW	13	9604561	missense	probably damaging	0.99
R3884:Dip2c	UTSW	13	9551858	missense	probably damaging	1.00
R4019:Dip2c	UTSW	13	9614365	missense	probably damaging	0.99
R4110:Dip2c	UTSW	13	9637101	missense	probably damaging	1.00
R4111:Dip2c	UTSW	13	9637101	missense	probably damaging	1.00
R4113:Dip2c	UTSW	13	9637101	missense	probably damaging	1.00
R4256:Dip2c	UTSW	13	9609056	missense	probably damaging	1.00
R4494:Dip2c	UTSW	13	9571062	missense	possibly damaging	0.64
R4739:Dip2c	UTSW	13	9533339	missense	probably damaging	0.98
R4812:Dip2c	UTSW	13	9637130	nonsense	probably null
R4814:Dip2c	UTSW	13	9536860	missense	probably benign	0.07
R4816:Dip2c	UTSW	13	9575150	missense	probably benign	0.37
R4828:Dip2c	UTSW	13	9560679	missense	probably damaging	1.00
R4915:Dip2c	UTSW	13	9621869	splice site	probably null
R4917:Dip2c	UTSW	13	9621869	splice site	probably null
R4932:Dip2c	UTSW	13	9623972	missense	probably damaging	0.99
R4993:Dip2c	UTSW	13	9575223	nonsense	probably null
R5043:Dip2c	UTSW	13	9551827	missense	possibly damaging	0.80
R5349:Dip2c	UTSW	13	9622653	missense	probably damaging	1.00
R5744:Dip2c	UTSW	13	9568405	missense	probably damaging	1.00
R5840:Dip2c	UTSW	13	9506676	missense	possibly damaging	0.68
R6110:Dip2c	UTSW	13	9623766	missense	probably damaging	1.00
R6160:Dip2c	UTSW	13	9533254	missense	probably benign	0.01
R6161:Dip2c	UTSW	13	9647007	missense	probably damaging	1.00
R6477:Dip2c	UTSW	13	9623760	missense	probably damaging	1.00
R6522:Dip2c	UTSW	13	9575228	critical splice donor site	probably null
R6603:Dip2c	UTSW	13	9654588	splice site	probably null
R6658:Dip2c	UTSW	13	9493177	critical splice donor site	probably null
R6672:Dip2c	UTSW	13	9567830	critical splice acceptor site	probably null
R6697:Dip2c	UTSW	13	9621913	missense	probably damaging	1.00
R6991:Dip2c	UTSW	13	9551860	nonsense	probably null
R6991:Dip2c	UTSW	13	9634832	missense	probably damaging	1.00
R7018:Dip2c	UTSW	13	9659278	missense	probably damaging	1.00
R7053:Dip2c	UTSW	13	9610704	missense	probably damaging	1.00
R7102:Dip2c	UTSW	13	9604536	missense	probably benign	0.01
R7171:Dip2c	UTSW	13	9506648	missense	probably benign	0.34
R7371:Dip2c	UTSW	13	9592749	missense	probably benign	0.02
R7395:Dip2c	UTSW	13	9614377	missense	probably damaging	1.00
R7489:Dip2c	UTSW	13	9533312	missense	probably damaging	0.99
R7575:Dip2c	UTSW	13	9628012	missense	probably damaging	0.97
R7642:Dip2c	UTSW	13	9622705	critical splice donor site	probably null
R7687:Dip2c	UTSW	13	9604581	missense	probably benign	0.00
R7699:Dip2c	UTSW	13	9659311	missense	probably benign	0.00
R7700:Dip2c	UTSW	13	9659311	missense	probably benign	0.00
R7715:Dip2c	UTSW	13	9614391	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTTATCCTCTGTACAGTAAACAC -3'
(R):5'- TCCTCAGCCTGCAACTGATAG -3'

Sequencing Primer
(F):5'- CTGTACAGTAAACACATGCATTTATG -3'
(R):5'- TTCAGAGATCCATGGCATACCTGG -3'

Posted On

2015-06-20