Mutagenetix > Incidental Mutation

Incidental Mutation 'R0001:Agbl1'

32239

Institutional Source

Beutler Lab

Gene Symbol

Agbl1

Ensembl Gene

ENSMUSG00000025754

Gene Name

ATP/GTP binding protein-like 1

Synonyms

Nna1-l1, EG244071

MMRRC Submission

038297-MU

Accession Numbers

Ncbi RefSeq: NM_001199224.1; MGI:3646469

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0001 (G1)

Quality Score

131

Status

Validated

Chromosome

Chromosomal Location

76229887-77124698 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 76419863 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 367 (H367L)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026854] [ENSMUST00000107442] [ENSMUST00000156166]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000026854
AA Change: H129L

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000026854
Gene: ENSMUSG00000025754
AA Change: H129L

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
Pfam:Peptidase_M14	493	631	4.4e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107442
AA Change: H129L

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000103066
Gene: ENSMUSG00000025754
AA Change: H129L

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
Pfam:Peptidase_M14	494	754	3.1e-27	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000156166
AA Change: H381L

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000119721
Gene: ENSMUSG00000025754
AA Change: H381L

Domain	Start	End	E-Value	Type
low complexity region	254	270	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000166190
AA Change: H367L

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000128342
Gene: ENSMUSG00000025754
AA Change: H367L

Domain	Start	End	E-Value	Type
low complexity region	286	302	N/A	INTRINSIC
Pfam:Peptidase_M14	737	871	7.4e-14	PFAM

Meta Mutation Damage Score

0.1055

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.6%

Validation Efficiency

99% (76/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyglutamylation is a reversible posttranslational modification catalyzed by polyglutamylases that results in the addition of glutamate side chains on the modified protein. This gene encodes a glutamate decarboxylase that catalyzes the deglutamylation of polyglutamylated proteins. Mutations in this gene result in dominant late-onset Fuchs corneal dystrophy. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700019N19Rik	G	A	19: 58,789,171	A61V	probably damaging	Het
2900092C05Rik	T	A	7: 12,554,607		probably benign	Het
A4galt	A	G	15: 83,228,289	F98L	probably benign	Het
Abca4	T	G	3: 122,081,011		probably benign	Het
Acacb	C	T	5: 114,204,833		probably benign	Het
Apoa4	C	A	9: 46,242,892	Q264K	probably benign	Het
Camsap2	A	T	1: 136,282,888		probably benign	Het
Cdan1	C	A	2: 120,723,751	R939L	probably benign	Het
Ceacam18	G	A	7: 43,636,876	V58I	possibly damaging	Het
Ciita	A	T	16: 10,514,433		probably benign	Het
Clk4	T	A	11: 51,268,765		probably benign	Het
Cntnap2	T	C	6: 46,530,171	D215G	probably benign	Het
Col11a2	T	C	17: 34,061,612	S1218P	probably benign	Het
Col20a1	T	C	2: 180,984,412		probably benign	Het
Ctsb	A	G	14: 63,135,622	E76G	probably benign	Het
Ctu2	T	C	8: 122,478,920	C161R	probably benign	Het
Dhx29	T	C	13: 112,964,556	L1211P	probably damaging	Het
Dhx9	G	T	1: 153,462,636	T759K	probably damaging	Het
Dmxl1	T	C	18: 49,888,897		probably benign	Het
Dpysl3	C	T	18: 43,358,375	E226K	possibly damaging	Het
Eif2d	A	T	1: 131,168,127	K453*	probably null	Het
Epha7	T	C	4: 28,961,279		probably benign	Het
Fam160b1	T	A	19: 57,381,756	H477Q	probably benign	Het
Fat3	T	C	9: 16,377,873	D118G	probably damaging	Het
Foxn4	T	A	5: 114,260,870	Q159L	probably damaging	Het
Frs2	G	T	10: 117,074,876	H194N	possibly damaging	Het
Fut8	A	T	12: 77,475,315	*576L	probably null	Het
Galns	T	C	8: 122,595,883		probably benign	Het
Gamt	G	A	10: 80,259,061		probably benign	Het
Gpn1	T	A	5: 31,495,617		probably benign	Het
Ipcef1	G	T	10: 6,900,600	H330Q	probably damaging	Het
Itga4	A	C	2: 79,326,587	Y1024S	probably damaging	Het
Jak2	A	G	19: 29,282,387	I229V	probably benign	Het
Katnal1	A	G	5: 148,921,275	S42P	probably damaging	Het
Kcnu1	A	T	8: 25,859,270	D142V	probably damaging	Het
Lig3	C	T	11: 82,790,591	R470W	probably damaging	Het
Mgat4c	A	G	10: 102,388,956	S344G	probably benign	Het
Miox	C	T	15: 89,336,274	L189F	possibly damaging	Het
Mipol1	C	T	12: 57,460,839		probably benign	Het
Mki67	C	T	7: 135,699,172	V1378M	probably damaging	Het
Mki67	T	A	7: 135,701,019	D762V	probably damaging	Het
Mmp9	A	G	2: 164,948,383	T43A	probably benign	Het
Muc6	T	C	7: 141,641,574	T1316A	possibly damaging	Het
Naip5	A	G	13: 100,214,650		probably null	Het
Naip5	C	A	13: 100,223,114	S538I	probably benign	Het
Nek3	A	T	8: 22,158,612		probably benign	Het
Nlrp1b	A	G	11: 71,161,759	S948P	probably damaging	Het
Nyap2	A	T	1: 81,192,107	H193L	probably benign	Het
Olfr1413	A	G	1: 92,573,461	K97E	possibly damaging	Het
Olfr648	T	A	7: 104,179,473	K312*	probably null	Het
Patl2	G	A	2: 122,125,710		probably benign	Het
Pcdhb11	A	T	18: 37,423,989	R791W	probably benign	Het
Pkd1l3	C	A	8: 109,628,633		probably benign	Het
Pkn2	A	T	3: 142,828,988	V73D	probably benign	Het
Pknox1	A	T	17: 31,599,636	H281L	probably damaging	Het
Polr3a	A	G	14: 24,452,189		probably benign	Het
Prss38	A	G	11: 59,373,180		probably benign	Het
Rad54l2	A	G	9: 106,708,217	F783S	probably damaging	Het
Rbm5	T	C	9: 107,742,424	R125G	probably damaging	Het
Rnpep	A	G	1: 135,272,485		probably benign	Het
Slc1a5	T	A	7: 16,793,637		probably null	Het
Slc22a4	G	A	11: 54,028,003		probably benign	Het
Spink12	T	C	18: 44,107,696	C50R	probably damaging	Het
Svep1	G	A	4: 58,066,460	T3208I	possibly damaging	Het
Tgm5	G	T	2: 121,077,646	D16E	probably damaging	Het
Tpp2	A	G	1: 43,971,726	N558D	probably benign	Het
Trappc9	A	T	15: 72,963,662	L507Q	probably damaging	Het
Trpm3	A	T	19: 22,715,331	Q262L	possibly damaging	Het
Ttn	A	G	2: 76,776,972		probably benign	Het
Ttn	G	A	2: 76,832,089		probably benign	Het
Ubr4	T	A	4: 139,451,788	L3316Q	probably damaging	Het
Uckl1	T	A	2: 181,574,655	Y136F	probably damaging	Het
Vmn1r28	G	A	6: 58,265,717	A182T	probably benign	Het
Vps39	A	G	2: 120,318,053	V870A	probably benign	Het
Zdhhc25	A	G	15: 88,600,909	D149G	probably benign	Het
Zfp648	C	T	1: 154,205,286	T397M	probably damaging	Het
Zic2	C	A	14: 122,478,957	T435K	probably damaging	Het

Other mutations in Agbl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01567:Agbl1	APN	7	76421880	missense	probably benign	0.01
IGL01650:Agbl1	APN	7	76420319	missense	probably damaging	1.00
IGL02244:Agbl1	APN	7	76766372	missense	probably damaging	1.00
IGL03088:Agbl1	APN	7	76720142	missense	probably benign	0.12
IGL03143:Agbl1	APN	7	76420045	nonsense	probably null
IGL03306:Agbl1	APN	7	76589504	missense	probably damaging	1.00
R0045:Agbl1	UTSW	7	76698840	critical splice donor site	probably null
R0045:Agbl1	UTSW	7	76698840	critical splice donor site	probably null
R0541:Agbl1	UTSW	7	76409245	missense	probably benign	0.22
R1889:Agbl1	UTSW	7	76589381	missense	probably damaging	1.00
R2089:Agbl1	UTSW	7	76589500	missense	probably damaging	0.98
R2091:Agbl1	UTSW	7	76589500	missense	probably damaging	0.98
R2091:Agbl1	UTSW	7	76589500	missense	probably damaging	0.98
R2127:Agbl1	UTSW	7	76419880	missense	possibly damaging	0.64
R2148:Agbl1	UTSW	7	76414717	splice site	probably null
R2229:Agbl1	UTSW	7	76433378	missense	probably benign	0.43
R2243:Agbl1	UTSW	7	76418722	missense	possibly damaging	0.93
R2255:Agbl1	UTSW	7	76422184	missense	probably damaging	1.00
R2411:Agbl1	UTSW	7	76720150	missense	probably damaging	1.00
R2426:Agbl1	UTSW	7	76421902	missense	probably damaging	1.00
R2508:Agbl1	UTSW	7	76589550	critical splice donor site	probably null
R2910:Agbl1	UTSW	7	76419838	missense	probably benign	0.13
R2919:Agbl1	UTSW	7	76414658	missense	probably damaging	1.00
R3056:Agbl1	UTSW	7	76766484	missense	possibly damaging	0.60
R3153:Agbl1	UTSW	7	76720196	missense	probably damaging	1.00
R3770:Agbl1	UTSW	7	76425929	critical splice donor site	probably null
R3825:Agbl1	UTSW	7	76419967	missense	probably damaging	0.99
R4632:Agbl1	UTSW	7	76413685	missense	probably benign	0.00
R4857:Agbl1	UTSW	7	76419835	missense	probably benign	0.03
R4943:Agbl1	UTSW	7	76420016	missense	probably benign	0.01
R5055:Agbl1	UTSW	7	76413577	missense	probably damaging	1.00
R5071:Agbl1	UTSW	7	76421917	missense	probably damaging	1.00
R5072:Agbl1	UTSW	7	76421917	missense	probably damaging	1.00
R5074:Agbl1	UTSW	7	76421917	missense	probably damaging	1.00
R5095:Agbl1	UTSW	7	76720133	missense	probably damaging	0.96
R5133:Agbl1	UTSW	7	76422156	missense	probably benign	0.21
R5576:Agbl1	UTSW	7	76335237	missense	probably benign	0.03
R5665:Agbl1	UTSW	7	76589503	missense	probably damaging	1.00
R5849:Agbl1	UTSW	7	76325098	missense	probably benign	0.35
R5924:Agbl1	UTSW	7	76409234	missense	probably benign	0.12
R6044:Agbl1	UTSW	7	76318120	missense	possibly damaging	0.56
R6117:Agbl1	UTSW	7	76698786	missense	probably damaging	1.00
R6144:Agbl1	UTSW	7	76420084	missense	probably benign	0.02
R6368:Agbl1	UTSW	7	76419830	missense	probably benign	0.25
R6806:Agbl1	UTSW	7	76425921	missense	probably damaging	1.00
R7455:Agbl1	UTSW	7	76424755	missense	unknown
R7459:Agbl1	UTSW	7	76420066	missense	not run
R7485:Agbl1	UTSW	7	76589493	missense	unknown
R7516:Agbl1	UTSW	7	76425921	missense	probably damaging	1.00
R7539:Agbl1	UTSW	7	76425929	critical splice donor site	probably null
R7561:Agbl1	UTSW	7	76698761	missense	unknown
R7630:Agbl1	UTSW	7	76886156	missense	unknown
R7655:Agbl1	UTSW	7	76409332	missense
R7656:Agbl1	UTSW	7	76409332	missense
R7658:Agbl1	UTSW	7	76766369	missense	unknown
R7681:Agbl1	UTSW	7	76444901	missense	unknown
R7694:Agbl1	UTSW	7	76698765	missense	unknown
R7773:Agbl1	UTSW	7	76698837	missense	unknown
R7981:Agbl1	UTSW	7	76444840	missense	unknown
R8208:Agbl1	UTSW	7	76720168	missense	unknown
R8317:Agbl1	UTSW	7	76422181	missense	unknown
R8406:Agbl1	UTSW	7	76418667	missense
R8432:Agbl1	UTSW	7	77124686	missense	unknown
R8704:Agbl1	UTSW	7	76589554	splice site	probably benign
R8830:Agbl1	UTSW	7	76335311	missense
R8985:Agbl1	UTSW	7	76320156	missense
R9113:Agbl1	UTSW	7	76589477	missense	unknown
R9170:Agbl1	UTSW	7	76335321	missense
R9229:Agbl1	UTSW	7	77124522	missense	unknown
R9255:Agbl1	UTSW	7	76766402	missense	unknown
R9391:Agbl1	UTSW	7	76421854	missense	unknown
R9646:Agbl1	UTSW	7	76425900	missense	unknown
Z1088:Agbl1	UTSW	7	76419904	missense	probably benign	0.00
Z1176:Agbl1	UTSW	7	76418685	missense
Z1177:Agbl1	UTSW	7	76720206	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AAATCAAAGGCACTGCCTGGGG -3'
(R):5'- TTTGAGGATGACGGTACACCGGAC -3'

Sequencing Primer
(F):5'- ATCCAAAGTCTCTTCTGAGAGCG -3'
(R):5'- GTACACCGGACTTCCCTG -3'

Posted On

2013-05-09