Incidental Mutation 'R4300:Spata31'
ID322390
Institutional Source Beutler Lab
Gene Symbol Spata31
Ensembl Gene ENSMUSG00000056223
Gene Namespermatogenesis associated 31
Synonyms4930458L03Rik, Fam75a, Spata31a
MMRRC Submission 041657-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R4300 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location64917406-64923194 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64919761 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 79 (H79L)
Ref Sequence ENSEMBL: ENSMUSP00000097025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070216] [ENSMUST00000221202]
Predicted Effect probably benign
Transcript: ENSMUST00000070216
AA Change: H79L

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000097025
Gene: ENSMUSG00000056223
AA Change: H79L

DomainStartEndE-ValueType
low complexity region 35 45 N/A INTRINSIC
low complexity region 91 106 N/A INTRINSIC
Pfam:FAM75 149 431 1.7e-83 PFAM
Pfam:FAM75 426 462 4.5e-9 PFAM
low complexity region 478 491 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221202
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik A G 18: 12,188,862 N513D probably benign Het
4930503B20Rik T A 3: 146,650,920 R78* probably null Het
A2m G A 6: 121,673,475 V1181I probably benign Het
Cacna1b T C 2: 24,635,239 S1639G probably damaging Het
Ccs T C 19: 4,834,257 T56A probably benign Het
Cd177 T C 7: 24,750,420 I547V possibly damaging Het
Ckmt2 C A 13: 91,863,338 probably null Het
Cyth1 A G 11: 118,183,894 F180L probably damaging Het
Dip2c A G 13: 9,610,711 I840M probably damaging Het
Gm37150 G A 9: 72,385,476 noncoding transcript Het
Herc1 A G 9: 66,489,406 D4255G probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnn4 G T 7: 24,377,604 V193L probably benign Het
Lrrc8d G A 5: 105,813,740 R672Q probably damaging Het
Mboat2 A G 12: 24,959,083 N463D probably benign Het
Mtfr1 T A 3: 19,215,457 probably null Het
Olfr192 T C 16: 59,098,278 Y238C unknown Het
Olfr981 A C 9: 40,023,139 I249L probably benign Het
Pcnt G C 10: 76,367,391 R2626G probably benign Het
Pik3cg A G 12: 32,176,672 I1072T probably damaging Het
Prc1 G A 7: 80,311,216 probably benign Het
Psph G T 5: 129,787,465 probably null Het
Rfx4 T C 10: 84,905,102 Y601H probably damaging Het
Setd5 T G 6: 113,150,162 V1249G probably damaging Het
Sirpb1b A T 3: 15,548,761 I87K probably damaging Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Srbd1 C A 17: 85,985,204 R979L probably damaging Het
Stox2 A T 8: 47,193,992 Y208* probably null Het
Sun1 A T 5: 139,227,594 probably benign Het
Tfap4 T C 16: 4,551,360 D132G probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tubgcp3 G T 8: 12,657,600 P130T probably damaging Het
Txlnb A G 10: 17,827,925 E277G probably damaging Het
Other mutations in Spata31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Spata31 APN 13 64922788 nonsense probably null
IGL01143:Spata31 APN 13 64920816 nonsense probably null
IGL01321:Spata31 APN 13 64921754 missense probably benign 0.01
IGL01624:Spata31 APN 13 64921585 missense probably damaging 1.00
IGL01844:Spata31 APN 13 64921154 missense possibly damaging 0.49
IGL02259:Spata31 APN 13 64921483 missense possibly damaging 0.90
IGL02358:Spata31 APN 13 64921218 missense probably benign
IGL02377:Spata31 APN 13 64920380 missense probably damaging 0.98
IGL02723:Spata31 APN 13 64920649 missense probably benign 0.10
IGL03125:Spata31 APN 13 64920889 missense probably benign 0.09
IGL03343:Spata31 APN 13 64919773 missense probably benign 0.41
BB006:Spata31 UTSW 13 64921718 missense probably benign 0.04
BB016:Spata31 UTSW 13 64921718 missense probably benign 0.04
F5770:Spata31 UTSW 13 64921648 missense probably benign 0.18
IGL02991:Spata31 UTSW 13 64920719 missense probably benign 0.05
P0043:Spata31 UTSW 13 64921006 splice site probably null
PIT4366001:Spata31 UTSW 13 64921505 nonsense probably null
PIT4458001:Spata31 UTSW 13 64921850 missense probably benign 0.01
PIT4687001:Spata31 UTSW 13 64921337 missense probably benign 0.02
R0042:Spata31 UTSW 13 64922563 missense probably benign 0.00
R0042:Spata31 UTSW 13 64922563 missense probably benign 0.00
R0064:Spata31 UTSW 13 64922098 missense probably damaging 0.98
R0064:Spata31 UTSW 13 64922098 missense probably damaging 0.98
R0639:Spata31 UTSW 13 64922213 missense probably benign 0.02
R1253:Spata31 UTSW 13 64922024 missense probably benign 0.23
R1536:Spata31 UTSW 13 64921382 missense probably damaging 1.00
R1656:Spata31 UTSW 13 64921139 missense probably benign
R1802:Spata31 UTSW 13 64922383 missense probably benign 0.01
R1813:Spata31 UTSW 13 64921798 missense probably benign 0.32
R1916:Spata31 UTSW 13 64922545 nonsense probably null
R1917:Spata31 UTSW 13 64920865 missense possibly damaging 0.92
R1933:Spata31 UTSW 13 64920610 missense probably benign 0.02
R2910:Spata31 UTSW 13 64920436 missense probably benign 0.12
R3750:Spata31 UTSW 13 64921743 missense probably benign 0.01
R3876:Spata31 UTSW 13 64920931 missense probably benign 0.03
R3980:Spata31 UTSW 13 64922654 missense probably benign 0.24
R4056:Spata31 UTSW 13 64921655 missense probably benign 0.00
R4797:Spata31 UTSW 13 64922742 nonsense probably null
R4997:Spata31 UTSW 13 64919723 missense probably benign 0.00
R5185:Spata31 UTSW 13 64917526 missense possibly damaging 0.93
R5366:Spata31 UTSW 13 64920459 missense probably damaging 0.98
R5539:Spata31 UTSW 13 64922969 missense probably benign 0.00
R5704:Spata31 UTSW 13 64922041 missense probably benign 0.32
R5748:Spata31 UTSW 13 64920313 makesense probably null
R5834:Spata31 UTSW 13 64922666 missense probably benign 0.19
R5926:Spata31 UTSW 13 64920725 missense possibly damaging 0.82
R6476:Spata31 UTSW 13 64917642 missense possibly damaging 0.68
R6603:Spata31 UTSW 13 64922665 missense probably damaging 1.00
R6620:Spata31 UTSW 13 64919757 missense possibly damaging 0.68
R6965:Spata31 UTSW 13 64922834 missense possibly damaging 0.90
R7086:Spata31 UTSW 13 64922229 missense probably benign 0.02
R7140:Spata31 UTSW 13 64921099 missense probably benign
R7396:Spata31 UTSW 13 64920733 missense probably benign
R7545:Spata31 UTSW 13 64922545 nonsense probably null
R7575:Spata31 UTSW 13 64922912 missense unknown
R7607:Spata31 UTSW 13 64921592 missense probably damaging 1.00
R7929:Spata31 UTSW 13 64921718 missense probably benign 0.04
R8024:Spata31 UTSW 13 64922804 missense probably benign 0.12
R8088:Spata31 UTSW 13 64920865 missense probably benign 0.31
R8323:Spata31 UTSW 13 64922251 missense possibly damaging 0.61
R8362:Spata31 UTSW 13 64922230 missense possibly damaging 0.58
R8870:Spata31 UTSW 13 64921004 missense probably benign
V7580:Spata31 UTSW 13 64921648 missense probably benign 0.18
V7581:Spata31 UTSW 13 64921648 missense probably benign 0.18
V7583:Spata31 UTSW 13 64921648 missense probably benign 0.18
Z1176:Spata31 UTSW 13 64921972 nonsense probably null
Z1177:Spata31 UTSW 13 64921972 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCTCTGCTAGTGACCACAC -3'
(R):5'- GCTCCTAAGAGTCTAGAGACCTTCC -3'

Sequencing Primer
(F):5'- GTGACCACACACACACACAC -3'
(R):5'- GTCTAGAGACCTTCCTGTTAGGAAC -3'
Posted On2015-06-20