Incidental Mutation 'R4300:Tfap4'
ID322393
Institutional Source Beutler Lab
Gene Symbol Tfap4
Ensembl Gene ENSMUSG00000005718
Gene Nametranscription factor AP4
SynonymsAP-4, bHLHc41, Tcfap4
MMRRC Submission 041657-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.765) question?
Stock #R4300 (G1)
Quality Score112
Status Validated
Chromosome16
Chromosomal Location4544661-4559854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4551360 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 132 (D132G)
Ref Sequence ENSEMBL: ENSMUSP00000005862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005862] [ENSMUST00000229956] [ENSMUST00000230875]
Predicted Effect probably damaging
Transcript: ENSMUST00000005862
AA Change: D132G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000005862
Gene: ENSMUSG00000005718
AA Change: D132G

DomainStartEndE-ValueType
low complexity region 41 52 N/A INTRINSIC
HLH 54 105 2.06e-16 SMART
coiled coil region 144 183 N/A INTRINSIC
low complexity region 193 210 N/A INTRINSIC
low complexity region 225 238 N/A INTRINSIC
low complexity region 306 327 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229956
AA Change: D112G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000230875
AA Change: D72G

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.0735 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcription factors of the basic helix-loop-helix-zipper (bHLH-ZIP) family contain a basic domain, which is used for DNA binding, and HLH and ZIP domains, which are used for oligomerization. Transcription factor AP4 activates both viral and cellular genes by binding to the symmetrical DNA sequence CAGCTG (Mermod et al., 1988 [PubMed 2833704]; Hu et al., 1990 [PubMed 2123466]).[supplied by OMIM, Jul 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial prenatal lethality and reduced suppression of Cd4 in double negative thymocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik A G 18: 12,188,862 N513D probably benign Het
4930503B20Rik T A 3: 146,650,920 R78* probably null Het
A2m G A 6: 121,673,475 V1181I probably benign Het
Cacna1b T C 2: 24,635,239 S1639G probably damaging Het
Ccs T C 19: 4,834,257 T56A probably benign Het
Cd177 T C 7: 24,750,420 I547V possibly damaging Het
Ckmt2 C A 13: 91,863,338 probably null Het
Cyth1 A G 11: 118,183,894 F180L probably damaging Het
Dip2c A G 13: 9,610,711 I840M probably damaging Het
Gm37150 G A 9: 72,385,476 noncoding transcript Het
Herc1 A G 9: 66,489,406 D4255G probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnn4 G T 7: 24,377,604 V193L probably benign Het
Lrrc8d G A 5: 105,813,740 R672Q probably damaging Het
Mboat2 A G 12: 24,959,083 N463D probably benign Het
Mtfr1 T A 3: 19,215,457 probably null Het
Olfr192 T C 16: 59,098,278 Y238C unknown Het
Olfr981 A C 9: 40,023,139 I249L probably benign Het
Pcnt G C 10: 76,367,391 R2626G probably benign Het
Pik3cg A G 12: 32,176,672 I1072T probably damaging Het
Prc1 G A 7: 80,311,216 probably benign Het
Psph G T 5: 129,787,465 probably null Het
Rfx4 T C 10: 84,905,102 Y601H probably damaging Het
Setd5 T G 6: 113,150,162 V1249G probably damaging Het
Sirpb1b A T 3: 15,548,761 I87K probably damaging Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Spata31 A T 13: 64,919,761 H79L probably benign Het
Srbd1 C A 17: 85,985,204 R979L probably damaging Het
Stox2 A T 8: 47,193,992 Y208* probably null Het
Sun1 A T 5: 139,227,594 probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tubgcp3 G T 8: 12,657,600 P130T probably damaging Het
Txlnb A G 10: 17,827,925 E277G probably damaging Het
Other mutations in Tfap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Tfap4 APN 16 4547359 missense probably damaging 1.00
IGL01816:Tfap4 APN 16 4552092 missense probably damaging 0.98
IGL02947:Tfap4 APN 16 4551360 missense probably damaging 0.99
E0370:Tfap4 UTSW 16 4559470 missense possibly damaging 0.53
R1311:Tfap4 UTSW 16 4559426 critical splice donor site probably null
R1791:Tfap4 UTSW 16 4552069 missense possibly damaging 0.53
R4371:Tfap4 UTSW 16 4551999 missense probably damaging 1.00
R5945:Tfap4 UTSW 16 4545629 missense possibly damaging 0.53
R6219:Tfap4 UTSW 16 4547311 missense probably damaging 0.96
R6738:Tfap4 UTSW 16 4549447 missense probably damaging 0.99
R7678:Tfap4 UTSW 16 4551766 missense possibly damaging 0.53
R8496:Tfap4 UTSW 16 4551306 missense probably damaging 0.99
R8854:Tfap4 UTSW 16 4549374 missense probably benign 0.03
X0065:Tfap4 UTSW 16 4547276 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCTGACTCTGGGCATCACAC -3'
(R):5'- CTAGAACGTAAGGCCATTCTTCC -3'

Sequencing Primer
(F):5'- ATCACACTGGCCAGCAGAGG -3'
(R):5'- ATTCTTCCACGCCTGCAGGG -3'
Posted On2015-06-20