Incidental Mutation 'R4301:Gmppa'
Institutional Source Beutler Lab
Gene Symbol Gmppa
Ensembl Gene ENSMUSG00000033021
Gene NameGDP-mannose pyrophosphorylase A
MMRRC Submission 041088-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.479) question?
Stock #R4301 (G1)
Quality Score225
Status Validated
Chromosomal Location75435930-75443179 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 75442496 bp
Amino Acid Change Arginine to Histidine at position 349 (R349H)
Ref Sequence ENSEMBL: ENSMUSP00000109214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037796] [ENSMUST00000113584] [ENSMUST00000131545] [ENSMUST00000133418] [ENSMUST00000140287] [ENSMUST00000141124] [ENSMUST00000143730] [ENSMUST00000144874] [ENSMUST00000145166] [ENSMUST00000188097]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037796
AA Change: R349H

PolyPhen 2 Score 0.774 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000035564
Gene: ENSMUSG00000033021
AA Change: R349H

Pfam:NTP_transferase 3 209 1.2e-30 PFAM
Pfam:NTP_transf_3 4 206 4.1e-10 PFAM
Pfam:Hexapep 280 321 2.6e-8 PFAM
low complexity region 357 365 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113584
AA Change: R349H

PolyPhen 2 Score 0.774 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109214
Gene: ENSMUSG00000033021
AA Change: R349H

Pfam:NTP_transferase 3 209 1.6e-28 PFAM
Pfam:NTP_transf_3 4 206 1.6e-9 PFAM
Pfam:Hexapep 286 321 4.3e-8 PFAM
low complexity region 357 365 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124539
Predicted Effect probably benign
Transcript: ENSMUST00000131545
SMART Domains Protein: ENSMUSP00000120841
Gene: ENSMUSG00000033021

Pfam:NTP_transferase 3 209 7.2e-31 PFAM
Pfam:NTP_transf_3 4 157 1.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132291
Predicted Effect probably benign
Transcript: ENSMUST00000133418
SMART Domains Protein: ENSMUSP00000122443
Gene: ENSMUSG00000033021

Pfam:NTP_transferase 3 209 6.8e-31 PFAM
Pfam:NTP_transf_3 4 204 1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135453
Predicted Effect probably benign
Transcript: ENSMUST00000140287
SMART Domains Protein: ENSMUSP00000121552
Gene: ENSMUSG00000033021

Pfam:NTP_transferase 3 161 1.7e-22 PFAM
Pfam:NTP_transf_3 4 155 6.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141124
SMART Domains Protein: ENSMUSP00000116783
Gene: ENSMUSG00000033021

Pfam:NTP_transferase 3 72 1.1e-13 PFAM
Pfam:NTP_transf_3 4 71 1.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143730
SMART Domains Protein: ENSMUSP00000114375
Gene: ENSMUSG00000033021

Pfam:NTP_transferase 3 196 1.1e-30 PFAM
Pfam:NTP_transf_3 4 173 9.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144874
SMART Domains Protein: ENSMUSP00000121418
Gene: ENSMUSG00000033021

Pfam:NTP_transferase 1 174 6.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145166
SMART Domains Protein: ENSMUSP00000116754
Gene: ENSMUSG00000033021

Pfam:NTP_transferase 3 91 5.2e-15 PFAM
Pfam:NTP_transf_3 4 88 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188097
SMART Domains Protein: ENSMUSP00000139936
Gene: ENSMUSG00000033021

Pfam:NTP_transferase 1 150 2.3e-15 PFAM
Pfam:NTP_transf_3 2 142 9.8e-7 PFAM
Meta Mutation Damage Score 0.0715 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to encode a GDP-mannose pyrophosphorylase. This enzyme catalyzes the reaction which converts mannose-1-phosphate and GTP to GDP-mannose which is involved in the production of N-linked oligosaccharides. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T A 16: 56,556,903 V95D probably damaging Het
Adamtsl2 A G 2: 27,087,283 D252G probably null Het
Adgra3 T C 5: 49,961,078 R1043G possibly damaging Het
Atxn7l1 A G 12: 33,367,238 D562G probably damaging Het
Ccdc70 T C 8: 21,973,212 V6A possibly damaging Het
Cdc25a T C 9: 109,889,742 V337A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Crb1 A G 1: 139,248,830 S472P probably benign Het
Fam193b G A 13: 55,542,604 R740* probably null Het
Fer G T 17: 64,078,910 L292F probably damaging Het
Hspa1a T C 17: 34,970,506 I474V probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc30 A G 17: 67,632,568 S6P probably damaging Het
Lzts3 A G 2: 130,636,438 S133P probably damaging Het
Mkl2 T C 16: 13,398,305 Y294H probably damaging Het
Mtmr12 T A 15: 12,236,020 F122I possibly damaging Het
Mypn A G 10: 63,118,484 Y124H probably damaging Het
Nfat5 T C 8: 107,355,695 probably benign Het
Npr2 T C 4: 43,641,332 probably null Het
Olfr1441 T C 19: 12,422,717 L136P probably damaging Het
Pgm1 G A 5: 64,103,797 W51* probably null Het
Phip G A 9: 82,959,713 R48* probably null Het
Piezo2 T C 18: 63,084,840 T1075A probably damaging Het
Ppat G T 5: 76,928,501 probably benign Het
Ppp2r2b T A 18: 42,898,746 E23D probably null Het
Prickle1 T C 15: 93,508,636 I169V possibly damaging Het
Rab37 T A 11: 115,158,564 D95E possibly damaging Het
Sash1 A G 10: 8,751,470 V50A probably benign Het
Siae C A 9: 37,633,713 Q335K possibly damaging Het
Snx14 A T 9: 88,410,623 I217K probably damaging Het
Son A G 16: 91,658,411 T1349A possibly damaging Het
Sptb A G 12: 76,612,697 L1143S probably damaging Het
Trim80 T C 11: 115,445,113 probably null Het
Trpm3 T C 19: 22,987,292 S1374P probably benign Het
Vldlr C A 19: 27,238,402 D266E possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zbtb10 A T 3: 9,265,160 Q526L probably damaging Het
Zfr2 T C 10: 81,242,184 probably benign Het
Zswim8 G A 14: 20,713,909 R449H possibly damaging Het
Zzef1 T C 11: 72,889,035 V1878A probably damaging Het
Other mutations in Gmppa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01871:Gmppa APN 1 75437017 missense probably damaging 0.98
IGL02418:Gmppa APN 1 75439020 missense probably damaging 1.00
IGL02899:Gmppa APN 1 75441830 splice site probably null
IGL03009:Gmppa APN 1 75439370 missense probably damaging 1.00
PIT4151001:Gmppa UTSW 1 75441824 nonsense probably null
R0708:Gmppa UTSW 1 75442574 missense probably damaging 1.00
R1352:Gmppa UTSW 1 75440534 missense probably benign 0.00
R1886:Gmppa UTSW 1 75442508 missense probably damaging 1.00
R2000:Gmppa UTSW 1 75441528 missense probably damaging 1.00
R3053:Gmppa UTSW 1 75441756 missense probably benign 0.04
R5054:Gmppa UTSW 1 75439371 nonsense probably null
R5791:Gmppa UTSW 1 75442255 missense possibly damaging 0.58
R6801:Gmppa UTSW 1 75441747 missense possibly damaging 0.94
R7806:Gmppa UTSW 1 75438937 missense probably damaging 1.00
R8105:Gmppa UTSW 1 75436997 missense possibly damaging 0.82
R8747:Gmppa UTSW 1 75439381 missense probably damaging 0.97
R8878:Gmppa UTSW 1 75438288 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-06-20