Incidental Mutation 'R4301:Lzts3'
ID322403
Institutional Source Beutler Lab
Gene Symbol Lzts3
Ensembl Gene ENSMUSG00000037703
Gene Nameleucine zipper, putative tumor suppressor family member 3
SynonymsProsapip1
MMRRC Submission 041088-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R4301 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location130632839-130642803 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130636438 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 133 (S133P)
Ref Sequence ENSEMBL: ENSMUSP00000105889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045761] [ENSMUST00000089561] [ENSMUST00000110260]
Predicted Effect probably damaging
Transcript: ENSMUST00000045761
AA Change: S247P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037109
Gene: ENSMUSG00000037703
AA Change: S247P

DomainStartEndE-ValueType
low complexity region 86 107 N/A INTRINSIC
low complexity region 147 158 N/A INTRINSIC
low complexity region 240 250 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
low complexity region 301 333 N/A INTRINSIC
low complexity region 337 346 N/A INTRINSIC
low complexity region 349 361 N/A INTRINSIC
low complexity region 402 436 N/A INTRINSIC
Pfam:Fez1 465 665 1.4e-62 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000089561
AA Change: S247P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000086990
Gene: ENSMUSG00000037703
AA Change: S247P

DomainStartEndE-ValueType
low complexity region 86 107 N/A INTRINSIC
low complexity region 147 158 N/A INTRINSIC
low complexity region 240 250 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
low complexity region 301 333 N/A INTRINSIC
low complexity region 337 346 N/A INTRINSIC
low complexity region 349 361 N/A INTRINSIC
low complexity region 402 436 N/A INTRINSIC
Pfam:Fez1 465 666 2.1e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110260
AA Change: S133P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105889
Gene: ENSMUSG00000037703
AA Change: S133P

DomainStartEndE-ValueType
low complexity region 126 136 N/A INTRINSIC
low complexity region 139 151 N/A INTRINSIC
low complexity region 171 183 N/A INTRINSIC
low complexity region 187 219 N/A INTRINSIC
low complexity region 223 232 N/A INTRINSIC
low complexity region 235 247 N/A INTRINSIC
low complexity region 288 322 N/A INTRINSIC
Pfam:Fez1 351 552 1.5e-74 PFAM
Meta Mutation Damage Score 0.312 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T A 16: 56,556,903 V95D probably damaging Het
Adamtsl2 A G 2: 27,087,283 D252G probably null Het
Adgra3 T C 5: 49,961,078 R1043G possibly damaging Het
Atxn7l1 A G 12: 33,367,238 D562G probably damaging Het
Ccdc70 T C 8: 21,973,212 V6A possibly damaging Het
Cdc25a T C 9: 109,889,742 V337A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Crb1 A G 1: 139,248,830 S472P probably benign Het
Fam193b G A 13: 55,542,604 R740* probably null Het
Fer G T 17: 64,078,910 L292F probably damaging Het
Gmppa G A 1: 75,442,496 R349H possibly damaging Het
Hspa1a T C 17: 34,970,506 I474V probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc30 A G 17: 67,632,568 S6P probably damaging Het
Mkl2 T C 16: 13,398,305 Y294H probably damaging Het
Mtmr12 T A 15: 12,236,020 F122I possibly damaging Het
Mypn A G 10: 63,118,484 Y124H probably damaging Het
Nfat5 T C 8: 107,355,695 probably benign Het
Npr2 T C 4: 43,641,332 probably null Het
Olfr1441 T C 19: 12,422,717 L136P probably damaging Het
Pgm1 G A 5: 64,103,797 W51* probably null Het
Phip G A 9: 82,959,713 R48* probably null Het
Piezo2 T C 18: 63,084,840 T1075A probably damaging Het
Ppat G T 5: 76,928,501 probably benign Het
Ppp2r2b T A 18: 42,898,746 E23D probably null Het
Prickle1 T C 15: 93,508,636 I169V possibly damaging Het
Rab37 T A 11: 115,158,564 D95E possibly damaging Het
Sash1 A G 10: 8,751,470 V50A probably benign Het
Siae C A 9: 37,633,713 Q335K possibly damaging Het
Snx14 A T 9: 88,410,623 I217K probably damaging Het
Son A G 16: 91,658,411 T1349A possibly damaging Het
Sptb A G 12: 76,612,697 L1143S probably damaging Het
Trim80 T C 11: 115,445,113 probably null Het
Trpm3 T C 19: 22,987,292 S1374P probably benign Het
Vldlr C A 19: 27,238,402 D266E possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zbtb10 A T 3: 9,265,160 Q526L probably damaging Het
Zfr2 T C 10: 81,242,184 probably benign Het
Zswim8 G A 14: 20,713,909 R449H possibly damaging Het
Zzef1 T C 11: 72,889,035 V1878A probably damaging Het
Other mutations in Lzts3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01072:Lzts3 APN 2 130635445 missense probably damaging 0.99
IGL01541:Lzts3 APN 2 130636206 missense probably damaging 0.99
IGL01649:Lzts3 APN 2 130635431 missense probably damaging 0.98
IGL02746:Lzts3 APN 2 130636341 missense probably damaging 0.98
IGL02927:Lzts3 APN 2 130637957 utr 5 prime probably benign
R0069:Lzts3 UTSW 2 130636540 missense probably benign 0.16
R0069:Lzts3 UTSW 2 130636540 missense probably benign 0.16
R0173:Lzts3 UTSW 2 130634768 makesense probably null
R1381:Lzts3 UTSW 2 130635299 missense probably damaging 0.99
R4127:Lzts3 UTSW 2 130635365 missense probably damaging 0.99
R4588:Lzts3 UTSW 2 130634766 makesense probably null
R5289:Lzts3 UTSW 2 130636101 missense probably benign 0.18
R5878:Lzts3 UTSW 2 130636539 missense probably damaging 1.00
R5964:Lzts3 UTSW 2 130636288 missense probably damaging 0.99
R6193:Lzts3 UTSW 2 130637386 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GACCCACTCTTACTGGAAGC -3'
(R):5'- CTTTTCTGCAGTGCTCGGAG -3'

Sequencing Primer
(F):5'- ACTCTTACTGGAAGCCCGCC -3'
(R):5'- AGTGCTCGGAGCCACTAGTTC -3'
Posted On2015-06-20