Mutagenetix > Incidental Mutations

Incidental Mutation 'R4301:Zbtb10'

322404

Institutional Source

Beutler Lab

Gene Symbol

Zbtb10

Ensembl Gene

ENSMUSG00000069114

Gene Name

zinc finger and BTB domain containing 10

Synonyms

MMRRC Submission

041088-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.315) question?

Stock #

R4301 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

9250602-9285333 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 9265160 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 526 (Q526L)

Ref Sequence

ENSEMBL: ENSMUSP00000119386 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000155203]

Predicted Effect

probably damaging
Transcript: ENSMUST00000155203
AA Change: Q526L

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000119386
Gene: ENSMUSG00000069114
AA Change: Q526L

Domain	Start	End	E-Value	Type
low complexity region	15	32	N/A	INTRINSIC
low complexity region	38	54	N/A	INTRINSIC
low complexity region	75	82	N/A	INTRINSIC
low complexity region	96	111	N/A	INTRINSIC
low complexity region	121	137	N/A	INTRINSIC
low complexity region	180	222	N/A	INTRINSIC
ZnF_TTF	239	321	7.92e-2	SMART
BTB	357	456	4.02e-20	SMART
internal_repeat_1	648	671	2.82e-12	PROSPERO
internal_repeat_1	672	695	2.82e-12	PROSPERO
ZnF_C2H2	714	736	6.78e-3	SMART
ZnF_C2H2	742	764	2.09e-3	SMART
low complexity region	765	777	N/A	INTRINSIC
low complexity region	823	842	N/A	INTRINSIC

Meta Mutation Damage Score

0.078

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (43/43)

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3bp	T	A	16: 56,556,903	V95D	probably damaging	Het
Adamtsl2	A	G	2: 27,087,283	D252G	probably null	Het
Adgra3	T	C	5: 49,961,078	R1043G	possibly damaging	Het
Atxn7l1	A	G	12: 33,367,238	D562G	probably damaging	Het
Ccdc70	T	C	8: 21,973,212	V6A	possibly damaging	Het
Cdc25a	T	C	9: 109,889,742	V337A	probably benign	Het
Chil4	G	A	3: 106,203,727	P284S	possibly damaging	Het
Crb1	A	G	1: 139,248,830	S472P	probably benign	Het
Fam193b	G	A	13: 55,542,604	R740*	probably null	Het
Fer	G	T	17: 64,078,910	L292F	probably damaging	Het
Gmppa	G	A	1: 75,442,496	R349H	possibly damaging	Het
Hspa1a	T	C	17: 34,970,506	I474V	probably benign	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906		probably benign	Het
Lrrc30	A	G	17: 67,632,568	S6P	probably damaging	Het
Lzts3	A	G	2: 130,636,438	S133P	probably damaging	Het
Mkl2	T	C	16: 13,398,305	Y294H	probably damaging	Het
Mtmr12	T	A	15: 12,236,020	F122I	possibly damaging	Het
Mypn	A	G	10: 63,118,484	Y124H	probably damaging	Het
Nfat5	T	C	8: 107,355,695		probably benign	Het
Npr2	T	C	4: 43,641,332		probably null	Het
Olfr1441	T	C	19: 12,422,717	L136P	probably damaging	Het
Pgm1	G	A	5: 64,103,797	W51*	probably null	Het
Phip	G	A	9: 82,959,713	R48*	probably null	Het
Piezo2	T	C	18: 63,084,840	T1075A	probably damaging	Het
Ppat	G	T	5: 76,928,501		probably benign	Het
Ppp2r2b	T	A	18: 42,898,746	E23D	probably null	Het
Prickle1	T	C	15: 93,508,636	I169V	possibly damaging	Het
Rab37	T	A	11: 115,158,564	D95E	possibly damaging	Het
Sash1	A	G	10: 8,751,470	V50A	probably benign	Het
Siae	C	A	9: 37,633,713	Q335K	possibly damaging	Het
Snx14	A	T	9: 88,410,623	I217K	probably damaging	Het
Son	A	G	16: 91,658,411	T1349A	possibly damaging	Het
Sptb	A	G	12: 76,612,697	L1143S	probably damaging	Het
Trim80	T	C	11: 115,445,113		probably null	Het
Trpm3	T	C	19: 22,987,292	S1374P	probably benign	Het
Vldlr	C	A	19: 27,238,402	D266E	possibly damaging	Het
Vmn2r79	A	G	7: 87,001,891	H166R	possibly damaging	Het
Zfr2	T	C	10: 81,242,184		probably benign	Het
Zswim8	G	A	14: 20,713,909	R449H	possibly damaging	Het
Zzef1	T	C	11: 72,889,035	V1878A	probably damaging	Het

Other mutations in Zbtb10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02174:Zbtb10	APN	3	9251812	missense	probably damaging	0.96
IGL02207:Zbtb10	APN	3	9280465	critical splice donor site	probably null
IGL02499:Zbtb10	APN	3	9251740	missense	probably damaging	1.00
IGL02506:Zbtb10	APN	3	9265237	missense	probably damaging	0.99
IGL03294:Zbtb10	APN	3	9280987	missense	probably benign	0.18
R0510:Zbtb10	UTSW	3	9264668	missense	probably damaging	1.00
R1859:Zbtb10	UTSW	3	9280386	missense	possibly damaging	0.47
R2342:Zbtb10	UTSW	3	9265195	missense	possibly damaging	0.60
R3407:Zbtb10	UTSW	3	9264866	missense	probably damaging	1.00
R4161:Zbtb10	UTSW	3	9280296	missense	probably damaging	1.00
R4698:Zbtb10	UTSW	3	9264550	missense	possibly damaging	0.87
R5184:Zbtb10	UTSW	3	9264671	missense	probably damaging	0.99
R5443:Zbtb10	UTSW	3	9280048	missense	probably benign
R5665:Zbtb10	UTSW	3	9265192	missense	probably damaging	0.99
R5744:Zbtb10	UTSW	3	9264563	missense	probably damaging	1.00
R5862:Zbtb10	UTSW	3	9265216	missense	probably damaging	0.98
R5909:Zbtb10	UTSW	3	9280049	missense	probably benign	0.14
R6547:Zbtb10	UTSW	3	9251703	missense	probably benign	0.38
R6612:Zbtb10	UTSW	3	9252065	missense	possibly damaging	0.87
R7457:Zbtb10	UTSW	3	9251478	missense	possibly damaging	0.77

Predicted Primers

PCR Primer
(F):5'- GTTGTGGACTATAACAATAGGAAGC -3'
(R):5'- TTCTTCTGGGTAGGCAGCAG -3'

Sequencing Primer
(F):5'- CTATAACAATAGGAAGCCAGTTAGC -3'
(R):5'- GGCTGCATCACTGAGCAATC -3'

Posted On

2015-06-20