Incidental Mutation 'R4301:Zbtb10'
ID322404
Institutional Source Beutler Lab
Gene Symbol Zbtb10
Ensembl Gene ENSMUSG00000069114
Gene Namezinc finger and BTB domain containing 10
Synonyms
MMRRC Submission 041088-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.315) question?
Stock #R4301 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location9250602-9285333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 9265160 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 526 (Q526L)
Ref Sequence ENSEMBL: ENSMUSP00000119386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000155203]
Predicted Effect probably damaging
Transcript: ENSMUST00000155203
AA Change: Q526L

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119386
Gene: ENSMUSG00000069114
AA Change: Q526L

DomainStartEndE-ValueType
low complexity region 15 32 N/A INTRINSIC
low complexity region 38 54 N/A INTRINSIC
low complexity region 75 82 N/A INTRINSIC
low complexity region 96 111 N/A INTRINSIC
low complexity region 121 137 N/A INTRINSIC
low complexity region 180 222 N/A INTRINSIC
ZnF_TTF 239 321 7.92e-2 SMART
BTB 357 456 4.02e-20 SMART
internal_repeat_1 648 671 2.82e-12 PROSPERO
internal_repeat_1 672 695 2.82e-12 PROSPERO
ZnF_C2H2 714 736 6.78e-3 SMART
ZnF_C2H2 742 764 2.09e-3 SMART
low complexity region 765 777 N/A INTRINSIC
low complexity region 823 842 N/A INTRINSIC
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T A 16: 56,556,903 V95D probably damaging Het
Adamtsl2 A G 2: 27,087,283 D252G probably null Het
Adgra3 T C 5: 49,961,078 R1043G possibly damaging Het
Atxn7l1 A G 12: 33,367,238 D562G probably damaging Het
Ccdc70 T C 8: 21,973,212 V6A possibly damaging Het
Cdc25a T C 9: 109,889,742 V337A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Crb1 A G 1: 139,248,830 S472P probably benign Het
Fam193b G A 13: 55,542,604 R740* probably null Het
Fer G T 17: 64,078,910 L292F probably damaging Het
Gmppa G A 1: 75,442,496 R349H possibly damaging Het
Hspa1a T C 17: 34,970,506 I474V probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc30 A G 17: 67,632,568 S6P probably damaging Het
Lzts3 A G 2: 130,636,438 S133P probably damaging Het
Mkl2 T C 16: 13,398,305 Y294H probably damaging Het
Mtmr12 T A 15: 12,236,020 F122I possibly damaging Het
Mypn A G 10: 63,118,484 Y124H probably damaging Het
Nfat5 T C 8: 107,355,695 probably benign Het
Npr2 T C 4: 43,641,332 probably null Het
Olfr1441 T C 19: 12,422,717 L136P probably damaging Het
Pgm1 G A 5: 64,103,797 W51* probably null Het
Phip G A 9: 82,959,713 R48* probably null Het
Piezo2 T C 18: 63,084,840 T1075A probably damaging Het
Ppat G T 5: 76,928,501 probably benign Het
Ppp2r2b T A 18: 42,898,746 E23D probably null Het
Prickle1 T C 15: 93,508,636 I169V possibly damaging Het
Rab37 T A 11: 115,158,564 D95E possibly damaging Het
Sash1 A G 10: 8,751,470 V50A probably benign Het
Siae C A 9: 37,633,713 Q335K possibly damaging Het
Snx14 A T 9: 88,410,623 I217K probably damaging Het
Son A G 16: 91,658,411 T1349A possibly damaging Het
Sptb A G 12: 76,612,697 L1143S probably damaging Het
Trim80 T C 11: 115,445,113 probably null Het
Trpm3 T C 19: 22,987,292 S1374P probably benign Het
Vldlr C A 19: 27,238,402 D266E possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zfr2 T C 10: 81,242,184 probably benign Het
Zswim8 G A 14: 20,713,909 R449H possibly damaging Het
Zzef1 T C 11: 72,889,035 V1878A probably damaging Het
Other mutations in Zbtb10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02174:Zbtb10 APN 3 9251812 missense probably damaging 0.96
IGL02207:Zbtb10 APN 3 9280465 critical splice donor site probably null
IGL02499:Zbtb10 APN 3 9251740 missense probably damaging 1.00
IGL02506:Zbtb10 APN 3 9265237 missense probably damaging 0.99
IGL03294:Zbtb10 APN 3 9280987 missense probably benign 0.18
R0510:Zbtb10 UTSW 3 9264668 missense probably damaging 1.00
R1859:Zbtb10 UTSW 3 9280386 missense possibly damaging 0.47
R2342:Zbtb10 UTSW 3 9265195 missense possibly damaging 0.60
R3407:Zbtb10 UTSW 3 9264866 missense probably damaging 1.00
R4161:Zbtb10 UTSW 3 9280296 missense probably damaging 1.00
R4698:Zbtb10 UTSW 3 9264550 missense possibly damaging 0.87
R5184:Zbtb10 UTSW 3 9264671 missense probably damaging 0.99
R5443:Zbtb10 UTSW 3 9280048 missense probably benign
R5665:Zbtb10 UTSW 3 9265192 missense probably damaging 0.99
R5744:Zbtb10 UTSW 3 9264563 missense probably damaging 1.00
R5862:Zbtb10 UTSW 3 9265216 missense probably damaging 0.98
R5909:Zbtb10 UTSW 3 9280049 missense probably benign 0.14
R6547:Zbtb10 UTSW 3 9251703 missense probably benign 0.38
R6612:Zbtb10 UTSW 3 9252065 missense possibly damaging 0.87
R7457:Zbtb10 UTSW 3 9251478 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GTTGTGGACTATAACAATAGGAAGC -3'
(R):5'- TTCTTCTGGGTAGGCAGCAG -3'

Sequencing Primer
(F):5'- CTATAACAATAGGAAGCCAGTTAGC -3'
(R):5'- GGCTGCATCACTGAGCAATC -3'
Posted On2015-06-20