Incidental Mutation 'R4301:Npr2'
Institutional Source Beutler Lab
Gene Symbol Npr2
Ensembl Gene ENSMUSG00000028469
Gene Namenatriuretic peptide receptor 2
Synonymspwe, cn, guanylyl cyclase-B
MMRRC Submission 041088-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.860) question?
Stock #R4301 (G1)
Quality Score225
Status Validated
Chromosomal Location43631935-43651244 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 43641332 bp
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000030191] [ENSMUST00000107874]
Predicted Effect probably benign
Transcript: ENSMUST00000030191
SMART Domains Protein: ENSMUSP00000030191
Gene: ENSMUSG00000028469

signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 44 399 1.9e-45 PFAM
Pfam:Pkinase_Tyr 518 786 4.7e-39 PFAM
Pfam:Pkinase 535 785 1.2e-32 PFAM
CYCc 825 1019 3.28e-111 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107874
SMART Domains Protein: ENSMUSP00000103506
Gene: ENSMUSG00000028469

signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 44 399 5.7e-56 PFAM
Pfam:Pkinase_Tyr 518 786 4.1e-39 PFAM
Pfam:Pkinase 533 785 3.8e-34 PFAM
CYCc 825 989 4.37e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123351
SMART Domains Protein: ENSMUSP00000117761
Gene: ENSMUSG00000028469

transmembrane domain 28 50 N/A INTRINSIC
Pfam:Pkinase_Tyr 71 173 1.3e-12 PFAM
Pfam:Pkinase 85 170 1.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123883
Predicted Effect probably null
Transcript: ENSMUST00000128549
SMART Domains Protein: ENSMUSP00000114385
Gene: ENSMUSG00000028469

transmembrane domain 21 43 N/A INTRINSIC
Pfam:Pkinase_Tyr 84 352 1e-39 PFAM
Pfam:Pkinase 101 351 2.6e-33 PFAM
CYCc 391 585 3.28e-111 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145817
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes natriuretic peptide receptor B, one of two integral membrane receptors for natriuretic peptides. Both NPR1 and NPR2 contain five functional domains: an extracellular ligand-binding domain, a single membrane-spanning region, and intracellularly a protein kinase homology domain, a helical hinge region involved in oligomerization, and a carboxyl-terminal guanylyl cyclase catalytic domain. The protein is the primary receptor for C-type natriuretic peptide (CNP), which upon ligand binding exhibits greatly increased guanylyl cyclase activity. Mutations in this gene are the cause of acromesomelic dysplasia Maroteaux type. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in skeletal abnormalities, malocclusion, and reduced viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T A 16: 56,556,903 V95D probably damaging Het
Adamtsl2 A G 2: 27,087,283 D252G probably null Het
Adgra3 T C 5: 49,961,078 R1043G possibly damaging Het
Atxn7l1 A G 12: 33,367,238 D562G probably damaging Het
Ccdc70 T C 8: 21,973,212 V6A possibly damaging Het
Cdc25a T C 9: 109,889,742 V337A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Crb1 A G 1: 139,248,830 S472P probably benign Het
Fam193b G A 13: 55,542,604 R740* probably null Het
Fer G T 17: 64,078,910 L292F probably damaging Het
Gmppa G A 1: 75,442,496 R349H possibly damaging Het
Hspa1a T C 17: 34,970,506 I474V probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc30 A G 17: 67,632,568 S6P probably damaging Het
Lzts3 A G 2: 130,636,438 S133P probably damaging Het
Mkl2 T C 16: 13,398,305 Y294H probably damaging Het
Mtmr12 T A 15: 12,236,020 F122I possibly damaging Het
Mypn A G 10: 63,118,484 Y124H probably damaging Het
Nfat5 T C 8: 107,355,695 probably benign Het
Olfr1441 T C 19: 12,422,717 L136P probably damaging Het
Pgm1 G A 5: 64,103,797 W51* probably null Het
Phip G A 9: 82,959,713 R48* probably null Het
Piezo2 T C 18: 63,084,840 T1075A probably damaging Het
Ppat G T 5: 76,928,501 probably benign Het
Ppp2r2b T A 18: 42,898,746 E23D probably null Het
Prickle1 T C 15: 93,508,636 I169V possibly damaging Het
Rab37 T A 11: 115,158,564 D95E possibly damaging Het
Sash1 A G 10: 8,751,470 V50A probably benign Het
Siae C A 9: 37,633,713 Q335K possibly damaging Het
Snx14 A T 9: 88,410,623 I217K probably damaging Het
Son A G 16: 91,658,411 T1349A possibly damaging Het
Sptb A G 12: 76,612,697 L1143S probably damaging Het
Trim80 T C 11: 115,445,113 probably null Het
Trpm3 T C 19: 22,987,292 S1374P probably benign Het
Vldlr C A 19: 27,238,402 D266E possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zbtb10 A T 3: 9,265,160 Q526L probably damaging Het
Zfr2 T C 10: 81,242,184 probably benign Het
Zswim8 G A 14: 20,713,909 R449H possibly damaging Het
Zzef1 T C 11: 72,889,035 V1878A probably damaging Het
Other mutations in Npr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Npr2 APN 4 43641612 missense possibly damaging 0.51
IGL01116:Npr2 APN 4 43640248 missense probably damaging 0.99
IGL01447:Npr2 APN 4 43640554 missense possibly damaging 0.93
IGL02412:Npr2 APN 4 43647005 missense probably damaging 0.97
IGL02449:Npr2 APN 4 43646641 missense probably damaging 1.00
IGL03120:Npr2 APN 4 43643133 missense probably damaging 0.99
IGL03351:Npr2 APN 4 43640652 missense probably benign 0.36
palmer UTSW 4 43647553 missense probably damaging 1.00
Plantar UTSW 4 43640597 missense probably damaging 1.00
R0066:Npr2 UTSW 4 43632329 missense probably benign 0.00
R0201:Npr2 UTSW 4 43641617 missense probably damaging 0.98
R0309:Npr2 UTSW 4 43640904 unclassified probably benign
R0437:Npr2 UTSW 4 43648082 missense probably damaging 1.00
R0440:Npr2 UTSW 4 43650315 missense probably damaging 0.99
R0464:Npr2 UTSW 4 43640597 splice site probably null
R0511:Npr2 UTSW 4 43632801 missense probably benign 0.00
R0576:Npr2 UTSW 4 43640947 missense probably benign 0.01
R0630:Npr2 UTSW 4 43641219 missense probably benign 0.18
R0690:Npr2 UTSW 4 43646991 missense probably damaging 0.98
R1079:Npr2 UTSW 4 43643654 missense probably damaging 1.00
R1140:Npr2 UTSW 4 43648353 missense possibly damaging 0.87
R1171:Npr2 UTSW 4 43647260 missense possibly damaging 0.52
R1741:Npr2 UTSW 4 43643350 missense probably damaging 1.00
R1848:Npr2 UTSW 4 43632384 missense probably benign
R1864:Npr2 UTSW 4 43641258 missense probably benign 0.30
R1919:Npr2 UTSW 4 43640578 missense probably damaging 1.00
R2054:Npr2 UTSW 4 43646560 missense probably damaging 0.99
R2106:Npr2 UTSW 4 43644329 missense probably damaging 1.00
R2143:Npr2 UTSW 4 43648166 missense probably damaging 1.00
R2306:Npr2 UTSW 4 43633609 missense probably damaging 1.00
R2372:Npr2 UTSW 4 43650432 missense probably damaging 1.00
R2889:Npr2 UTSW 4 43641600 missense probably benign 0.26
R3076:Npr2 UTSW 4 43640182 missense probably damaging 1.00
R3078:Npr2 UTSW 4 43640182 missense probably damaging 1.00
R3711:Npr2 UTSW 4 43643378 missense probably benign 0.00
R3730:Npr2 UTSW 4 43640999 missense possibly damaging 0.93
R4352:Npr2 UTSW 4 43646592 missense probably damaging 1.00
R4412:Npr2 UTSW 4 43644150 missense probably damaging 0.99
R4583:Npr2 UTSW 4 43633522 splice site probably null
R4593:Npr2 UTSW 4 43647323 unclassified probably benign
R5042:Npr2 UTSW 4 43647002 missense probably damaging 1.00
R5213:Npr2 UTSW 4 43640673 critical splice donor site probably null
R5546:Npr2 UTSW 4 43650150 missense probably damaging 1.00
R5784:Npr2 UTSW 4 43632801 missense probably benign 0.00
R5787:Npr2 UTSW 4 43633593 missense possibly damaging 0.69
R6364:Npr2 UTSW 4 43643622 missense probably damaging 1.00
R6925:Npr2 UTSW 4 43647553 missense probably damaging 1.00
R6949:Npr2 UTSW 4 43640597 missense probably damaging 1.00
R7380:Npr2 UTSW 4 43641254 missense probably damaging 1.00
R7432:Npr2 UTSW 4 43647155 missense probably damaging 0.96
R7500:Npr2 UTSW 4 43650415 missense probably damaging 1.00
R8235:Npr2 UTSW 4 43641603 missense probably benign 0.09
R8292:Npr2 UTSW 4 43643086 missense possibly damaging 0.70
Z1176:Npr2 UTSW 4 43650720 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-06-20