Mutagenetix > Incidental Mutations

Incidental Mutation 'R4301:Adgra3'

322407

Institutional Source

Beutler Lab

Gene Symbol

Adgra3

Ensembl Gene

ENSMUSG00000029090

Gene Name

adhesion G protein-coupled receptor A3

Synonyms

Gpr125, Tem5-like, 3830613O22Rik

MMRRC Submission

041088-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4301 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

49959956-50059006 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 49961078 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 1043 (R1043G)

Ref Sequence

ENSEMBL: ENSMUSP00000030971 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030971]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030971
AA Change: R1043G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000030971
Gene: ENSMUSG00000029090
AA Change: R1043G

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	36	48	N/A	INTRINSIC
LRR	68	92	1.71e1	SMART
LRR_TYP	93	116	2.27e-4	SMART
LRR_TYP	117	140	4.11e-2	SMART
LRR_TYP	141	164	3.89e-3	SMART
LRRCT	176	225	5.24e-5	SMART
IG	238	331	8.26e-5	SMART
GPS	686	738	4.81e-3	SMART
Pfam:7tm_2	746	1031	1.6e-16	PFAM
low complexity region	1251	1262	N/A	INTRINSIC

Meta Mutation Damage Score

0.5639

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled receptor superfamily. This membrane protein may play a role in tumor angiogenesis through its interaction with the human homolog of the Drosophila disc large tumor suppressor gene. This gene is mapped to a candidate region of chromosome 4 which may be associated with bipolar disorder and schizophrenia. [provided by RefSeq, Oct 2012]
PHENOTYPE: Homozygous mutant mice are fertile and grossly normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3bp	T	A	16: 56,556,903	V95D	probably damaging	Het
Adamtsl2	A	G	2: 27,087,283	D252G	probably null	Het
Atxn7l1	A	G	12: 33,367,238	D562G	probably damaging	Het
Ccdc70	T	C	8: 21,973,212	V6A	possibly damaging	Het
Cdc25a	T	C	9: 109,889,742	V337A	probably benign	Het
Chil4	G	A	3: 106,203,727	P284S	possibly damaging	Het
Crb1	A	G	1: 139,248,830	S472P	probably benign	Het
Fam193b	G	A	13: 55,542,604	R740*	probably null	Het
Fer	G	T	17: 64,078,910	L292F	probably damaging	Het
Gmppa	G	A	1: 75,442,496	R349H	possibly damaging	Het
Hspa1a	T	C	17: 34,970,506	I474V	probably benign	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906		probably benign	Het
Lrrc30	A	G	17: 67,632,568	S6P	probably damaging	Het
Lzts3	A	G	2: 130,636,438	S133P	probably damaging	Het
Mkl2	T	C	16: 13,398,305	Y294H	probably damaging	Het
Mtmr12	T	A	15: 12,236,020	F122I	possibly damaging	Het
Mypn	A	G	10: 63,118,484	Y124H	probably damaging	Het
Nfat5	T	C	8: 107,355,695		probably benign	Het
Npr2	T	C	4: 43,641,332		probably null	Het
Olfr1441	T	C	19: 12,422,717	L136P	probably damaging	Het
Pgm1	G	A	5: 64,103,797	W51*	probably null	Het
Phip	G	A	9: 82,959,713	R48*	probably null	Het
Piezo2	T	C	18: 63,084,840	T1075A	probably damaging	Het
Ppat	G	T	5: 76,928,501		probably benign	Het
Ppp2r2b	T	A	18: 42,898,746	E23D	probably null	Het
Prickle1	T	C	15: 93,508,636	I169V	possibly damaging	Het
Rab37	T	A	11: 115,158,564	D95E	possibly damaging	Het
Sash1	A	G	10: 8,751,470	V50A	probably benign	Het
Siae	C	A	9: 37,633,713	Q335K	possibly damaging	Het
Snx14	A	T	9: 88,410,623	I217K	probably damaging	Het
Son	A	G	16: 91,658,411	T1349A	possibly damaging	Het
Sptb	A	G	12: 76,612,697	L1143S	probably damaging	Het
Trim80	T	C	11: 115,445,113		probably null	Het
Trpm3	T	C	19: 22,987,292	S1374P	probably benign	Het
Vldlr	C	A	19: 27,238,402	D266E	possibly damaging	Het
Vmn2r79	A	G	7: 87,001,891	H166R	possibly damaging	Het
Zbtb10	A	T	3: 9,265,160	Q526L	probably damaging	Het
Zfr2	T	C	10: 81,242,184		probably benign	Het
Zswim8	G	A	14: 20,713,909	R449H	possibly damaging	Het
Zzef1	T	C	11: 72,889,035	V1878A	probably damaging	Het

Other mutations in Adgra3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00777:Adgra3	APN	5	50025758	missense	probably damaging	1.00
IGL00848:Adgra3	APN	5	50001949	missense	probably damaging	1.00
IGL01455:Adgra3	APN	5	49987557	nonsense	probably null
IGL01665:Adgra3	APN	5	50006930	missense	possibly damaging	0.64
IGL02151:Adgra3	APN	5	49979142	missense	probably benign
IGL02239:Adgra3	APN	5	49960712	missense	probably damaging	1.00
IGL02351:Adgra3	APN	5	50058558	missense	probably benign	0.19
IGL02358:Adgra3	APN	5	50058558	missense	probably benign	0.19
IGL02938:Adgra3	APN	5	49961317	missense	probably benign	0.01
IGL03028:Adgra3	APN	5	50016852	missense	probably benign	0.30
aperture	UTSW	5	49999145	nonsense	probably null
saltatory	UTSW	5	49960559	missense	probably benign	0.09
ANU74:Adgra3	UTSW	5	49961038	missense	probably benign	0.16
R0041:Adgra3	UTSW	5	49960559	missense	probably benign	0.09
R0121:Adgra3	UTSW	5	50025786	splice site	probably benign
R0125:Adgra3	UTSW	5	50001852	splice site	probably benign
R0137:Adgra3	UTSW	5	49963840	splice site	probably benign
R0415:Adgra3	UTSW	5	49961757	splice site	probably benign
R0479:Adgra3	UTSW	5	49990265	missense	probably benign	0.00
R0505:Adgra3	UTSW	5	50009334	critical splice donor site	probably null
R0831:Adgra3	UTSW	5	49970802	missense	probably damaging	1.00
R0883:Adgra3	UTSW	5	49960723	missense	probably damaging	1.00
R0920:Adgra3	UTSW	5	49961161	missense	probably benign	0.19
R1139:Adgra3	UTSW	5	49961755	splice site	probably null
R1211:Adgra3	UTSW	5	50006876	missense	possibly damaging	0.88
R1370:Adgra3	UTSW	5	49960787	missense	possibly damaging	0.56
R1530:Adgra3	UTSW	5	49961137	missense	probably benign	0.00
R1703:Adgra3	UTSW	5	50006775	missense	probably benign	0.00
R1782:Adgra3	UTSW	5	49972062	missense	probably benign	0.02
R1843:Adgra3	UTSW	5	49961492	missense	probably damaging	1.00
R2157:Adgra3	UTSW	5	50001941	missense	possibly damaging	0.87
R2281:Adgra3	UTSW	5	50001880	missense	probably benign	0.04
R2385:Adgra3	UTSW	5	49979566	missense	possibly damaging	0.95
R2426:Adgra3	UTSW	5	50009449	missense	possibly damaging	0.61
R3084:Adgra3	UTSW	5	50013391	critical splice donor site	probably null
R3086:Adgra3	UTSW	5	50013391	critical splice donor site	probably null
R3409:Adgra3	UTSW	5	50001930	missense	probably damaging	1.00
R3410:Adgra3	UTSW	5	50001930	missense	probably damaging	1.00
R3411:Adgra3	UTSW	5	50001930	missense	probably damaging	1.00
R4360:Adgra3	UTSW	5	49990210	missense	possibly damaging	0.92
R4475:Adgra3	UTSW	5	50001898	missense	probably damaging	1.00
R4569:Adgra3	UTSW	5	49960563	missense	probably damaging	1.00
R4607:Adgra3	UTSW	5	49970739	missense	probably damaging	0.98
R4667:Adgra3	UTSW	5	49978956	missense	possibly damaging	0.94
R4671:Adgra3	UTSW	5	49979368	missense	probably damaging	1.00
R4886:Adgra3	UTSW	5	49999195	missense	probably benign	0.07
R5197:Adgra3	UTSW	5	49960754	missense	probably benign	0.01
R5208:Adgra3	UTSW	5	50011515	missense	probably damaging	0.99
R5313:Adgra3	UTSW	5	49961309	missense	probably benign	0.24
R5435:Adgra3	UTSW	5	49990126	missense	probably damaging	0.99
R5663:Adgra3	UTSW	5	49999285	missense	probably benign	0.14
R6038:Adgra3	UTSW	5	49999145	nonsense	probably null
R6038:Adgra3	UTSW	5	49999145	nonsense	probably null
R6064:Adgra3	UTSW	5	49960325	missense	probably damaging	0.97
R6259:Adgra3	UTSW	5	49999141	missense	possibly damaging	0.63
R6272:Adgra3	UTSW	5	50009449	missense	possibly damaging	0.61
R6293:Adgra3	UTSW	5	49960847	missense	probably benign	0.21
R6296:Adgra3	UTSW	5	49960847	missense	probably benign	0.21
R6297:Adgra3	UTSW	5	49960847	missense	probably benign	0.21
R6352:Adgra3	UTSW	5	49979136	missense	probably benign
R6352:Adgra3	UTSW	5	49990250	missense	probably benign	0.01
R6989:Adgra3	UTSW	5	50006884	missense	probably damaging	1.00
R7026:Adgra3	UTSW	5	49960741	missense	probably benign
R7147:Adgra3	UTSW	5	49961245	missense	probably damaging	1.00
R7206:Adgra3	UTSW	5	50006896	missense	probably damaging	1.00
R7381:Adgra3	UTSW	5	50058774	start codon destroyed	probably null
R7508:Adgra3	UTSW	5	50016867	missense	probably benign	0.10
R7538:Adgra3	UTSW	5	49961450	missense	probably benign	0.01
R7579:Adgra3	UTSW	5	49987635	missense	probably benign
R8269:Adgra3	UTSW	5	49963737	missense	probably damaging	0.98
RF005:Adgra3	UTSW	5	50013387	splice site	probably null
RF024:Adgra3	UTSW	5	50013387	splice site	probably null
RF036:Adgra3	UTSW	5	50058641	small deletion	probably benign
X0065:Adgra3	UTSW	5	49971962	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGCCTGCAAGTTTGTCAGC -3'
(R):5'- GAACGAGCACAGTTTTCAGTCTC -3'

Sequencing Primer
(F):5'- AAGTTTGTCAGCTTGCAGCC -3'
(R):5'- TCAGTCTCAGCTTCTGGGCG -3'

Posted On

2015-06-20