Incidental Mutation 'R4301:Pgm1'
Institutional Source Beutler Lab
Gene Symbol Pgm1
Ensembl Gene ENSMUSG00000029171
Gene Namephosphoglucomutase 1
SynonymsPgm-1, 3230402E02Rik
MMRRC Submission 041088-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4301 (G1)
Quality Score225
Status Validated
Chromosomal Location64092950-64128351 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 64103797 bp
Amino Acid Change Tryptophan to Stop codon at position 51 (W51*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087324]
Predicted Effect probably null
Transcript: ENSMUST00000087324
AA Change: W211*
SMART Domains Protein: ENSMUSP00000084582
Gene: ENSMUSG00000029171
AA Change: W211*

low complexity region 2 13 N/A INTRINSIC
Pfam:PGM_PMM_I 62 211 7.8e-37 PFAM
Pfam:PGM_PMM_II 235 344 1.9e-25 PFAM
Pfam:PGM_PMM_III 351 480 4.6e-15 PFAM
Pfam:PGM_PMM_IV 523 603 5.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177427
Predicted Effect probably null
Transcript: ENSMUST00000199093
AA Change: W51*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
MGI Phenotype PHENOTYPE: Four electrophoretic variants are known, each with a 5-band pattern: the a allele in C57BL/6, BALB/c and AKR; b allele in DBA/2 and SJL; c allele in C3H/He; and d allele in 129/Re. Heterozygotes show a mixture of bands. Mice homozygous for a spontaneous null allele or ENU induced alleles are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T A 16: 56,556,903 V95D probably damaging Het
Adamtsl2 A G 2: 27,087,283 D252G probably null Het
Adgra3 T C 5: 49,961,078 R1043G possibly damaging Het
Atxn7l1 A G 12: 33,367,238 D562G probably damaging Het
Ccdc70 T C 8: 21,973,212 V6A possibly damaging Het
Cdc25a T C 9: 109,889,742 V337A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Crb1 A G 1: 139,248,830 S472P probably benign Het
Fam193b G A 13: 55,542,604 R740* probably null Het
Fer G T 17: 64,078,910 L292F probably damaging Het
Gmppa G A 1: 75,442,496 R349H possibly damaging Het
Hspa1a T C 17: 34,970,506 I474V probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc30 A G 17: 67,632,568 S6P probably damaging Het
Lzts3 A G 2: 130,636,438 S133P probably damaging Het
Mkl2 T C 16: 13,398,305 Y294H probably damaging Het
Mtmr12 T A 15: 12,236,020 F122I possibly damaging Het
Mypn A G 10: 63,118,484 Y124H probably damaging Het
Nfat5 T C 8: 107,355,695 probably benign Het
Npr2 T C 4: 43,641,332 probably null Het
Olfr1441 T C 19: 12,422,717 L136P probably damaging Het
Phip G A 9: 82,959,713 R48* probably null Het
Piezo2 T C 18: 63,084,840 T1075A probably damaging Het
Ppat G T 5: 76,928,501 probably benign Het
Ppp2r2b T A 18: 42,898,746 E23D probably null Het
Prickle1 T C 15: 93,508,636 I169V possibly damaging Het
Rab37 T A 11: 115,158,564 D95E possibly damaging Het
Sash1 A G 10: 8,751,470 V50A probably benign Het
Siae C A 9: 37,633,713 Q335K possibly damaging Het
Snx14 A T 9: 88,410,623 I217K probably damaging Het
Son A G 16: 91,658,411 T1349A possibly damaging Het
Sptb A G 12: 76,612,697 L1143S probably damaging Het
Trim80 T C 11: 115,445,113 probably null Het
Trpm3 T C 19: 22,987,292 S1374P probably benign Het
Vldlr C A 19: 27,238,402 D266E possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zbtb10 A T 3: 9,265,160 Q526L probably damaging Het
Zfr2 T C 10: 81,242,184 probably benign Het
Zswim8 G A 14: 20,713,909 R449H possibly damaging Het
Zzef1 T C 11: 72,889,035 V1878A probably damaging Het
Other mutations in Pgm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Pgm1 APN 5 64108269 splice site probably benign
IGL01068:Pgm1 APN 5 64107796 missense probably damaging 0.99
IGL01112:Pgm1 APN 5 64102882 missense possibly damaging 0.86
IGL01634:Pgm1 APN 5 64100974 missense probably benign 0.01
IGL02513:Pgm1 APN 5 64102946 unclassified probably benign
R0255:Pgm1 UTSW 5 64112043 missense possibly damaging 0.93
R0268:Pgm1 UTSW 5 64105808 missense probably damaging 1.00
R0511:Pgm1 UTSW 5 64110555 missense probably damaging 1.00
R0722:Pgm1 UTSW 5 64107679 nonsense probably null
R0881:Pgm1 UTSW 5 64093008 missense unknown
R0924:Pgm1 UTSW 5 64112147 missense possibly damaging 0.90
R0930:Pgm1 UTSW 5 64112147 missense possibly damaging 0.90
R1773:Pgm1 UTSW 5 64107851 critical splice donor site probably null
R1777:Pgm1 UTSW 5 64127782 missense probably benign
R2137:Pgm1 UTSW 5 64116366 missense probably benign
R2244:Pgm1 UTSW 5 64106702 missense probably benign 0.00
R3946:Pgm1 UTSW 5 64112061 missense probably benign
R4601:Pgm1 UTSW 5 64107727 missense probably benign 0.02
R4631:Pgm1 UTSW 5 64105947 splice site probably null
R4795:Pgm1 UTSW 5 64103874 missense probably damaging 1.00
R4871:Pgm1 UTSW 5 64103894 missense probably benign
R4893:Pgm1 UTSW 5 64105940 missense probably benign
R4907:Pgm1 UTSW 5 64103878 missense probably benign 0.00
R4915:Pgm1 UTSW 5 64100948 missense probably damaging 1.00
R5092:Pgm1 UTSW 5 64107749 missense possibly damaging 0.49
R5197:Pgm1 UTSW 5 64105832 missense possibly damaging 0.87
R5621:Pgm1 UTSW 5 64112038 nonsense probably null
R6311:Pgm1 UTSW 5 64116415 missense probably benign 0.05
R6651:Pgm1 UTSW 5 64112094 missense probably benign 0.07
R6731:Pgm1 UTSW 5 64100975 missense probably benign 0.27
R6885:Pgm1 UTSW 5 64103878 missense probably benign 0.00
R6919:Pgm1 UTSW 5 64097025 missense probably benign 0.11
R7211:Pgm1 UTSW 5 64105850 missense probably damaging 0.99
R7631:Pgm1 UTSW 5 64108179 missense possibly damaging 0.90
R7982:Pgm1 UTSW 5 64100959 missense probably damaging 1.00
R8070:Pgm1 UTSW 5 64112082 missense probably benign 0.00
R8161:Pgm1 UTSW 5 64112160 missense probably damaging 1.00
R8181:Pgm1 UTSW 5 64112124 missense possibly damaging 0.83
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-06-20