Mutagenetix > Incidental Mutation

Incidental Mutation 'R4301:Phip'

322415

Institutional Source

Beutler Lab

Gene Symbol

Phip

Ensembl Gene

ENSMUSG00000032253

Gene Name

pleckstrin homology domain interacting protein

Synonyms

Wdr11, 2810004D21Rik, 4632404O06Rik, Ndrp

MMRRC Submission

041088-MU

Accession Numbers

Genbank: NM_001081216; MGI: 1932404

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4301 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82866159-82975516 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 82959713 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 48 (R48*)

Ref Sequence

ENSEMBL: ENSMUSP00000140445 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034787] [ENSMUST00000189985]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000034787
AA Change: R110*

SMART Domains

Protein: ENSMUSP00000034787
Gene: ENSMUSG00000032253
AA Change: R110*

Domain	Start	End	E-Value	Type
WD40	172	211	1.5e-8	SMART
WD40	214	253	4.1e-9	SMART
WD40	256	299	3.5e-7	SMART
WD40	310	349	1.4e-1	SMART
WD40	354	393	6.6e-10	SMART
WD40	408	452	1.4e-2	SMART
WD40	455	495	3.4e-10	SMART
WD40	498	542	6.6e-2	SMART
low complexity region	802	813	N/A	INTRINSIC
low complexity region	841	854	N/A	INTRINSIC
low complexity region	865	877	N/A	INTRINSIC
coiled coil region	881	907	N/A	INTRINSIC
low complexity region	928	941	N/A	INTRINSIC
BROMO	1158	1261	3.5e-11	SMART
BROMO	1318	1423	4.1e-30	SMART
low complexity region	1438	1463	N/A	INTRINSIC
low complexity region	1500	1513	N/A	INTRINSIC
low complexity region	1708	1721	N/A	INTRINSIC
low complexity region	1752	1758	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187021

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188828

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188868

Predicted Effect

probably null
Transcript: ENSMUST00000189985
AA Change: R48*

SMART Domains

Protein: ENSMUSP00000140445
Gene: ENSMUSG00000032253
AA Change: R48*

Domain	Start	End	E-Value	Type
WD40	110	149	1.5e-8	SMART
WD40	152	191	4e-9	SMART
WD40	194	237	3.5e-7	SMART
WD40	248	287	1.4e-1	SMART
WD40	292	331	6.5e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190838

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to the insulin receptor substrate 1 protein and regulates glucose transporter translocation in skeletal muscle cells. The encoded protein may also regulate growth and survival of pancreatic beta cells. Elevated copy number of this gene may be associated with melanoma severity and the encoded protein may promote melanoma metastasis in human patients. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit postnatal and premature lethality associated with reduced body size, small myocardial cells and hepatocytes, hypoglycemia, increased insulin sensitivity, and reduced cell growth. [provided by MGI curators]

Allele List at MGI

All alleles(34) : Gene trapped(34)

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3bp	T	A	16: 56,556,903	V95D	probably damaging	Het
Adamtsl2	A	G	2: 27,087,283	D252G	probably null	Het
Adgra3	T	C	5: 49,961,078	R1043G	possibly damaging	Het
Atxn7l1	A	G	12: 33,367,238	D562G	probably damaging	Het
Ccdc70	T	C	8: 21,973,212	V6A	possibly damaging	Het
Cdc25a	T	C	9: 109,889,742	V337A	probably benign	Het
Chil4	G	A	3: 106,203,727	P284S	possibly damaging	Het
Crb1	A	G	1: 139,248,830	S472P	probably benign	Het
Fam193b	G	A	13: 55,542,604	R740*	probably null	Het
Fer	G	T	17: 64,078,910	L292F	probably damaging	Het
Gmppa	G	A	1: 75,442,496	R349H	possibly damaging	Het
Hspa1a	T	C	17: 34,970,506	I474V	probably benign	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906	74	probably benign	Het
Lrrc30	A	G	17: 67,632,568	S6P	probably damaging	Het
Lzts3	A	G	2: 130,636,438	S133P	probably damaging	Het
Mkl2	T	C	16: 13,398,305	Y294H	probably damaging	Het
Mtmr12	T	A	15: 12,236,020	F122I	possibly damaging	Het
Mypn	A	G	10: 63,118,484	Y124H	probably damaging	Het
Nfat5	T	C	8: 107,355,695		probably benign	Het
Npr2	T	C	4: 43,641,332		probably null	Het
Olfr1441	T	C	19: 12,422,717	L136P	probably damaging	Het
Pgm1	G	A	5: 64,103,797	W51*	probably null	Het
Piezo2	T	C	18: 63,084,840	T1075A	probably damaging	Het
Ppat	G	T	5: 76,928,501		probably benign	Het
Ppp2r2b	T	A	18: 42,898,746	E23D	probably null	Het
Prickle1	T	C	15: 93,508,636	I169V	possibly damaging	Het
Rab37	T	A	11: 115,158,564	D95E	possibly damaging	Het
Sash1	A	G	10: 8,751,470	V50A	probably benign	Het
Siae	C	A	9: 37,633,713	Q335K	possibly damaging	Het
Snx14	A	T	9: 88,410,623	I217K	probably damaging	Het
Son	A	G	16: 91,658,411	T1349A	possibly damaging	Het
Sptb	A	G	12: 76,612,697	L1143S	probably damaging	Het
Trim80	T	C	11: 115,445,113		probably null	Het
Trpm3	T	C	19: 22,987,292	S1374P	probably benign	Het
Vldlr	C	A	19: 27,238,402	D266E	possibly damaging	Het
Vmn2r79	A	G	7: 87,001,891	H166R	possibly damaging	Het
Zbtb10	A	T	3: 9,265,160	Q526L	probably damaging	Het
Zfr2	T	C	10: 81,242,184		probably benign	Het
Zswim8	G	A	14: 20,713,909	R449H	possibly damaging	Het
Zzef1	T	C	11: 72,889,035	V1878A	probably damaging	Het

Other mutations in Phip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00809:Phip	APN	9	82871303	missense	probably damaging	0.99
IGL01510:Phip	APN	9	82913871	missense	probably benign	0.01
IGL01916:Phip	APN	9	82890469	missense	possibly damaging	0.61
IGL02068:Phip	APN	9	82945808	missense	probably damaging	1.00
IGL02089:Phip	APN	9	82871319	missense	probably damaging	1.00
IGL02121:Phip	APN	9	82893370	missense	probably damaging	1.00
IGL02132:Phip	APN	9	82881341	missense	possibly damaging	0.91
IGL02146:Phip	APN	9	82881718	missense	probably benign	0.05
IGL02282:Phip	APN	9	82913690	missense	probably benign	0.09
IGL02341:Phip	APN	9	82932883	missense	probably damaging	1.00
IGL02342:Phip	APN	9	82886692	missense	probably damaging	1.00
IGL02470:Phip	APN	9	82890454	missense	possibly damaging	0.69
IGL02585:Phip	APN	9	82903188	missense	probably benign	0.03
IGL03271:Phip	APN	9	82884824	splice site	probably benign
3-1:Phip	UTSW	9	82886671	missense	probably damaging	1.00
R0102:Phip	UTSW	9	82905792	splice site	probably null
R0102:Phip	UTSW	9	82905792	splice site	probably null
R0137:Phip	UTSW	9	82927191	splice site	probably null
R0268:Phip	UTSW	9	82871288	missense	probably damaging	1.00
R0366:Phip	UTSW	9	82926407	missense	probably damaging	1.00
R0421:Phip	UTSW	9	82926457	missense	probably damaging	1.00
R0481:Phip	UTSW	9	82876716	splice site	probably benign
R0883:Phip	UTSW	9	82876221	missense	probably benign	0.01
R0885:Phip	UTSW	9	82875395	missense	probably benign	0.06
R1300:Phip	UTSW	9	82876747	missense	probably benign	0.00
R1434:Phip	UTSW	9	82959605	missense	probably damaging	0.99
R1448:Phip	UTSW	9	82915423	missense	possibly damaging	0.92
R1588:Phip	UTSW	9	82900828	missense	probably damaging	1.00
R1619:Phip	UTSW	9	82871449	missense	probably benign	0.20
R1658:Phip	UTSW	9	82871498	missense	probably benign
R1688:Phip	UTSW	9	82871657	missense	probably benign
R1773:Phip	UTSW	9	82876189	missense	probably benign
R1865:Phip	UTSW	9	82945792	missense	probably damaging	1.00
R1934:Phip	UTSW	9	82903182	missense	probably benign	0.11
R2070:Phip	UTSW	9	82875299	missense	probably benign
R2096:Phip	UTSW	9	82915339	missense	possibly damaging	0.95
R2097:Phip	UTSW	9	82915339	missense	possibly damaging	0.95
R2099:Phip	UTSW	9	82915339	missense	possibly damaging	0.95
R2192:Phip	UTSW	9	82871815	missense	probably damaging	0.99
R2402:Phip	UTSW	9	82875305	missense	probably benign
R2447:Phip	UTSW	9	82915399	missense	probably damaging	0.99
R2504:Phip	UTSW	9	82915339	missense	possibly damaging	0.95
R2507:Phip	UTSW	9	82915339	missense	possibly damaging	0.95
R2508:Phip	UTSW	9	82915339	missense	possibly damaging	0.95
R3706:Phip	UTSW	9	82900743	missense	probably benign	0.02
R3829:Phip	UTSW	9	82871645	missense	probably benign
R3846:Phip	UTSW	9	82876126	nonsense	probably null
R4366:Phip	UTSW	9	82900869	intron	probably benign
R4748:Phip	UTSW	9	82908869	missense	probably benign	0.01
R4895:Phip	UTSW	9	82959595	missense	probably benign	0.20
R5001:Phip	UTSW	9	82896019	splice site	probably null
R5094:Phip	UTSW	9	82871844	missense	probably benign
R5181:Phip	UTSW	9	82871190	utr 3 prime	probably benign
R5194:Phip	UTSW	9	82908862	missense	probably benign	0.03
R5291:Phip	UTSW	9	82945883	missense	probably damaging	1.00
R5335:Phip	UTSW	9	82900756	missense	possibly damaging	0.93
R5458:Phip	UTSW	9	82926500	missense	probably benign	0.40
R5704:Phip	UTSW	9	82871355	missense	probably damaging	0.97
R5866:Phip	UTSW	9	82890150	missense	probably benign
R5870:Phip	UTSW	9	82908677	splice site	probably benign
R5890:Phip	UTSW	9	82906952	missense	probably benign	0.00
R6232:Phip	UTSW	9	82903181	missense	probably benign
R6379:Phip	UTSW	9	82913857	missense	probably damaging	0.98
R6653:Phip	UTSW	9	82900741	nonsense	probably null
R7129:Phip	UTSW	9	82877300	missense	probably damaging	0.98
R7290:Phip	UTSW	9	82871293	missense	possibly damaging	0.94
R7598:Phip	UTSW	9	82905658	missense	possibly damaging	0.94
R7632:Phip	UTSW	9	82903190	missense	probably benign
R7752:Phip	UTSW	9	82890150	missense	probably benign
R7827:Phip	UTSW	9	82908833	missense	probably benign
R7901:Phip	UTSW	9	82890150	missense	probably benign
R7960:Phip	UTSW	9	82893348	missense	probably benign	0.00
R8006:Phip	UTSW	9	82890126	missense	possibly damaging	0.93
R8066:Phip	UTSW	9	82875298	missense	probably benign	0.05
R8080:Phip	UTSW	9	82887609	missense	probably damaging	1.00
R8135:Phip	UTSW	9	82930374	missense	probably benign	0.09
R8347:Phip	UTSW	9	82908763	missense	probably benign	0.02
R8459:Phip	UTSW	9	82876053	missense	probably benign
R8705:Phip	UTSW	9	82893559	missense	probably damaging	0.99
R8706:Phip	UTSW	9	82905712	missense	possibly damaging	0.89
R8743:Phip	UTSW	9	82927087	missense	probably benign	0.18
R8801:Phip	UTSW	9	82876252	missense	probably benign	0.22
R8930:Phip	UTSW	9	82906988	missense	possibly damaging	0.67
R8932:Phip	UTSW	9	82906988	missense	possibly damaging	0.67
R8969:Phip	UTSW	9	82926964	intron	probably benign
R9064:Phip	UTSW	9	82871487	missense	probably benign	0.20
R9332:Phip	UTSW	9	82875359	missense	probably damaging	0.98
R9335:Phip	UTSW	9	82932926	missense	probably benign	0.03
R9520:Phip	UTSW	9	82871384	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- ATTCTTTACCCAGAGGACATCAC -3'
(R):5'- GGGACATAATAGGTGCCTGTG -3'

Sequencing Primer
(F):5'- GCTACCGTAGTTAACTGGAGACTC -3'
(R):5'- GCCTGTGTCTGTTTTTGACAAAATAG -3'

Posted On

2015-06-20