Incidental Mutation 'R4301:Snx14'
Institutional Source Beutler Lab
Gene Symbol Snx14
Ensembl Gene ENSMUSG00000032422
Gene Namesorting nexin 14
SynonymsC330035N22Rik, YR-14
MMRRC Submission 041088-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4301 (G1)
Quality Score225
Status Validated
Chromosomal Location88376750-88438958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88410623 bp
Amino Acid Change Isoleucine to Lysine at position 217 (I217K)
Ref Sequence ENSEMBL: ENSMUSP00000133507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126405] [ENSMUST00000165315] [ENSMUST00000173011] [ENSMUST00000173039] [ENSMUST00000174806]
Predicted Effect probably benign
Transcript: ENSMUST00000126405
SMART Domains Protein: ENSMUSP00000116773
Gene: ENSMUSG00000032422

transmembrane domain 57 76 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PXA 157 210 3.9e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165315
AA Change: I217K

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130116
Gene: ENSMUSG00000032422
AA Change: I217K

transmembrane domain 54 73 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
Pfam:PXA 157 330 8.2e-49 PFAM
Pfam:RGS 363 495 4.3e-13 PFAM
PX 585 704 8.77e-13 SMART
low complexity region 771 785 N/A INTRINSIC
Pfam:Nexin_C 825 930 2e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173011
AA Change: I217K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133507
Gene: ENSMUSG00000032422
AA Change: I217K

transmembrane domain 54 73 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
Pfam:PXA 157 330 3.1e-49 PFAM
Pfam:RGS 363 482 3.1e-9 PFAM
low complexity region 499 513 N/A INTRINSIC
Pfam:Nexin_C 553 658 7.2e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173039
AA Change: I173K

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133624
Gene: ENSMUSG00000032422
AA Change: I173K

transmembrane domain 54 73 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
Pfam:PXA 154 286 6.5e-33 PFAM
Pfam:RGS 319 451 2.6e-13 PFAM
PX 541 660 8.77e-13 SMART
low complexity region 727 741 N/A INTRINSIC
Pfam:Nexin_C 781 886 1.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173131
SMART Domains Protein: ENSMUSP00000134122
Gene: ENSMUSG00000092541

low complexity region 1 26 N/A INTRINSIC
low complexity region 30 58 N/A INTRINSIC
low complexity region 62 88 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000174806
AA Change: I217K

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133533
Gene: ENSMUSG00000032422
AA Change: I217K

transmembrane domain 54 73 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
Pfam:PXA 158 327 1.9e-44 PFAM
Pfam:RGS 363 495 1.3e-13 PFAM
PX 594 713 8.77e-13 SMART
low complexity region 780 794 N/A INTRINSIC
Pfam:Nexin_C 834 938 2.8e-18 PFAM
Meta Mutation Damage Score 0.9000 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family have a phox (PX) phosphoinositide binding domain and are involved in intracellular trafficking. The encoded protein also contains a regulator of G protein signaling (RGS) domain. Regulator of G protein signaling family members are regulatory molecules that act as GTPase activating proteins for G alpha subunits of heterotrimeric G proteins. Alternate splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T A 16: 56,556,903 V95D probably damaging Het
Adamtsl2 A G 2: 27,087,283 D252G probably null Het
Adgra3 T C 5: 49,961,078 R1043G possibly damaging Het
Atxn7l1 A G 12: 33,367,238 D562G probably damaging Het
Ccdc70 T C 8: 21,973,212 V6A possibly damaging Het
Cdc25a T C 9: 109,889,742 V337A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Crb1 A G 1: 139,248,830 S472P probably benign Het
Fam193b G A 13: 55,542,604 R740* probably null Het
Fer G T 17: 64,078,910 L292F probably damaging Het
Gmppa G A 1: 75,442,496 R349H possibly damaging Het
Hspa1a T C 17: 34,970,506 I474V probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc30 A G 17: 67,632,568 S6P probably damaging Het
Lzts3 A G 2: 130,636,438 S133P probably damaging Het
Mkl2 T C 16: 13,398,305 Y294H probably damaging Het
Mtmr12 T A 15: 12,236,020 F122I possibly damaging Het
Mypn A G 10: 63,118,484 Y124H probably damaging Het
Nfat5 T C 8: 107,355,695 probably benign Het
Npr2 T C 4: 43,641,332 probably null Het
Olfr1441 T C 19: 12,422,717 L136P probably damaging Het
Pgm1 G A 5: 64,103,797 W51* probably null Het
Phip G A 9: 82,959,713 R48* probably null Het
Piezo2 T C 18: 63,084,840 T1075A probably damaging Het
Ppat G T 5: 76,928,501 probably benign Het
Ppp2r2b T A 18: 42,898,746 E23D probably null Het
Prickle1 T C 15: 93,508,636 I169V possibly damaging Het
Rab37 T A 11: 115,158,564 D95E possibly damaging Het
Sash1 A G 10: 8,751,470 V50A probably benign Het
Siae C A 9: 37,633,713 Q335K possibly damaging Het
Son A G 16: 91,658,411 T1349A possibly damaging Het
Sptb A G 12: 76,612,697 L1143S probably damaging Het
Trim80 T C 11: 115,445,113 probably null Het
Trpm3 T C 19: 22,987,292 S1374P probably benign Het
Vldlr C A 19: 27,238,402 D266E possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zbtb10 A T 3: 9,265,160 Q526L probably damaging Het
Zfr2 T C 10: 81,242,184 probably benign Het
Zswim8 G A 14: 20,713,909 R449H possibly damaging Het
Zzef1 T C 11: 72,889,035 V1878A probably damaging Het
Other mutations in Snx14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Snx14 APN 9 88402190 missense probably damaging 0.99
IGL00773:Snx14 APN 9 88394539 missense probably damaging 0.96
IGL00847:Snx14 APN 9 88420329 missense probably damaging 1.00
IGL01526:Snx14 APN 9 88381500 missense probably damaging 0.99
IGL01662:Snx14 APN 9 88385838 splice site probably benign
IGL01928:Snx14 APN 9 88381512 missense probably benign 0.04
IGL02225:Snx14 APN 9 88413524 missense probably damaging 0.99
IGL02498:Snx14 APN 9 88407464 missense probably damaging 1.00
IGL02585:Snx14 APN 9 88404518 missense possibly damaging 0.92
IGL02634:Snx14 APN 9 88403303 missense probably damaging 1.00
IGL03073:Snx14 APN 9 88422896 critical splice donor site probably null
R0167:Snx14 UTSW 9 88407416 missense probably damaging 1.00
R0324:Snx14 UTSW 9 88405238 critical splice donor site probably null
R0627:Snx14 UTSW 9 88394430 missense probably benign
R0862:Snx14 UTSW 9 88383996 missense possibly damaging 0.81
R0864:Snx14 UTSW 9 88383996 missense possibly damaging 0.81
R0973:Snx14 UTSW 9 88400721 critical splice donor site probably null
R0973:Snx14 UTSW 9 88400721 critical splice donor site probably null
R0974:Snx14 UTSW 9 88400721 critical splice donor site probably null
R1478:Snx14 UTSW 9 88394528 missense probably benign 0.00
R1511:Snx14 UTSW 9 88398364 nonsense probably null
R1522:Snx14 UTSW 9 88402224 missense possibly damaging 0.52
R1612:Snx14 UTSW 9 88376905 missense possibly damaging 0.81
R1634:Snx14 UTSW 9 88385739 missense probably benign 0.00
R1634:Snx14 UTSW 9 88407490 splice site probably benign
R1704:Snx14 UTSW 9 88413538 missense probably damaging 1.00
R1713:Snx14 UTSW 9 88415675 missense probably damaging 1.00
R1883:Snx14 UTSW 9 88402261 missense probably benign 0.01
R3701:Snx14 UTSW 9 88420243 splice site probably benign
R3853:Snx14 UTSW 9 88407319 splice site probably benign
R4449:Snx14 UTSW 9 88422999 missense probably benign 0.05
R4793:Snx14 UTSW 9 88394442 missense probably damaging 0.98
R4934:Snx14 UTSW 9 88398288 missense probably damaging 0.98
R5126:Snx14 UTSW 9 88382099 missense probably damaging 1.00
R5227:Snx14 UTSW 9 88398294 missense possibly damaging 0.77
R5518:Snx14 UTSW 9 88383802 missense probably damaging 1.00
R5838:Snx14 UTSW 9 88391776 missense probably damaging 1.00
R5957:Snx14 UTSW 9 88403274 missense possibly damaging 0.84
R6153:Snx14 UTSW 9 88391806 missense probably damaging 1.00
R6156:Snx14 UTSW 9 88407339 missense possibly damaging 0.92
R6703:Snx14 UTSW 9 88422914 missense probably damaging 0.96
R6784:Snx14 UTSW 9 88381792 missense probably benign 0.01
R6823:Snx14 UTSW 9 88394382 missense possibly damaging 0.90
R6837:Snx14 UTSW 9 88380223 missense probably benign 0.07
R7169:Snx14 UTSW 9 88398309 missense probably damaging 0.98
R7216:Snx14 UTSW 9 88381791 missense probably damaging 0.99
R7224:Snx14 UTSW 9 88394561 missense possibly damaging 0.92
R7357:Snx14 UTSW 9 88404316 missense possibly damaging 0.49
R7738:Snx14 UTSW 9 88407474 missense probably benign 0.00
R7743:Snx14 UTSW 9 88398349 missense probably benign 0.01
R7969:Snx14 UTSW 9 88413560 missense probably damaging 1.00
R8016:Snx14 UTSW 9 88415687 missense probably damaging 0.99
R8384:Snx14 UTSW 9 88403280 nonsense probably null
R8492:Snx14 UTSW 9 88381816 missense possibly damaging 0.94
R8686:Snx14 UTSW 9 88415693 missense probably damaging 1.00
R8738:Snx14 UTSW 9 88407400 missense possibly damaging 0.93
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-06-20