Incidental Mutation 'R4301:Sash1'
ID 322418
Institutional Source Beutler Lab
Gene Symbol Sash1
Ensembl Gene ENSMUSG00000015305
Gene Name SAM and SH3 domain containing 1
MMRRC Submission 041088-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4301 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 8722219-8886070 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 8751470 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 50 (V50A)
Ref Sequence ENSEMBL: ENSMUSP00000148780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015449] [ENSMUST00000212553] [ENSMUST00000212869]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000015449
AA Change: V286A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000015449
Gene: ENSMUSG00000015305
AA Change: V286A

low complexity region 2 21 N/A INTRINSIC
coiled coil region 185 212 N/A INTRINSIC
low complexity region 323 336 N/A INTRINSIC
Pfam:SLY 394 548 1.2e-46 PFAM
SH3 550 607 1.16e-3 SMART
SAM 623 690 1.83e-11 SMART
low complexity region 1008 1021 N/A INTRINSIC
SAM 1157 1224 3.6e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212553
AA Change: V54A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000212869
AA Change: V50A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0621 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein involved in the TLR4 signaling pathway that may stimulate cytokine production and endothelial cell migration in response to invading pathogens. The encoded protein has also been described as a potential tumor suppressor that may negatively regulate proliferation, apoptosis, and invasion of cancer cells, and reduced expression of this gene has been observed in multiple human cancers. Mutations in this gene may be associated with abnormal skin pigmentation in human patients. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T A 16: 56,556,903 V95D probably damaging Het
Adamtsl2 A G 2: 27,087,283 D252G probably null Het
Adgra3 T C 5: 49,961,078 R1043G possibly damaging Het
Atxn7l1 A G 12: 33,367,238 D562G probably damaging Het
Ccdc70 T C 8: 21,973,212 V6A possibly damaging Het
Cdc25a T C 9: 109,889,742 V337A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Crb1 A G 1: 139,248,830 S472P probably benign Het
Fam193b G A 13: 55,542,604 R740* probably null Het
Fer G T 17: 64,078,910 L292F probably damaging Het
Gmppa G A 1: 75,442,496 R349H possibly damaging Het
Hspa1a T C 17: 34,970,506 I474V probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Lrrc30 A G 17: 67,632,568 S6P probably damaging Het
Lzts3 A G 2: 130,636,438 S133P probably damaging Het
Mkl2 T C 16: 13,398,305 Y294H probably damaging Het
Mtmr12 T A 15: 12,236,020 F122I possibly damaging Het
Mypn A G 10: 63,118,484 Y124H probably damaging Het
Nfat5 T C 8: 107,355,695 probably benign Het
Npr2 T C 4: 43,641,332 probably null Het
Olfr1441 T C 19: 12,422,717 L136P probably damaging Het
Pgm1 G A 5: 64,103,797 W51* probably null Het
Phip G A 9: 82,959,713 R48* probably null Het
Piezo2 T C 18: 63,084,840 T1075A probably damaging Het
Ppat G T 5: 76,928,501 probably benign Het
Ppp2r2b T A 18: 42,898,746 E23D probably null Het
Prickle1 T C 15: 93,508,636 I169V possibly damaging Het
Rab37 T A 11: 115,158,564 D95E possibly damaging Het
Siae C A 9: 37,633,713 Q335K possibly damaging Het
Snx14 A T 9: 88,410,623 I217K probably damaging Het
Son A G 16: 91,658,411 T1349A possibly damaging Het
Sptb A G 12: 76,612,697 L1143S probably damaging Het
Trim80 T C 11: 115,445,113 probably null Het
Trpm3 T C 19: 22,987,292 S1374P probably benign Het
Vldlr C A 19: 27,238,402 D266E possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zbtb10 A T 3: 9,265,160 Q526L probably damaging Het
Zfr2 T C 10: 81,242,184 probably benign Het
Zswim8 G A 14: 20,713,909 R449H possibly damaging Het
Zzef1 T C 11: 72,889,035 V1878A probably damaging Het
Other mutations in Sash1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Sash1 APN 10 8751413 missense probably damaging 1.00
IGL01535:Sash1 APN 10 8741577 missense probably damaging 1.00
IGL01537:Sash1 APN 10 8729658 missense probably damaging 1.00
IGL01788:Sash1 APN 10 8733646 missense probably benign 0.01
IGL01933:Sash1 APN 10 8751133 missense probably damaging 0.99
IGL02126:Sash1 APN 10 8739465 missense probably damaging 0.96
IGL02285:Sash1 APN 10 8740334 missense probably damaging 0.99
IGL02400:Sash1 APN 10 8733647 nonsense probably null
IGL02504:Sash1 APN 10 8729912 missense probably benign 0.00
IGL02630:Sash1 APN 10 8744535 missense probably benign 0.06
boyscout UTSW 10 8742422 splice site probably null
cubscout UTSW 10 8729713 missense probably benign 0.01
R0592:Sash1 UTSW 10 8729782 missense probably benign 0.00
R0647:Sash1 UTSW 10 8729552 missense probably damaging 0.99
R0656:Sash1 UTSW 10 8751137 critical splice donor site probably null
R0830:Sash1 UTSW 10 8729909 missense probably benign 0.01
R0919:Sash1 UTSW 10 8730079 missense probably benign 0.01
R1470:Sash1 UTSW 10 8789593 missense probably damaging 1.00
R1470:Sash1 UTSW 10 8789593 missense probably damaging 1.00
R1606:Sash1 UTSW 10 8729957 missense probably benign 0.00
R1707:Sash1 UTSW 10 8730377 missense probably benign 0.00
R1922:Sash1 UTSW 10 8727908 missense possibly damaging 0.62
R1940:Sash1 UTSW 10 8729932 missense probably benign
R1964:Sash1 UTSW 10 8729713 missense probably benign 0.01
R2013:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2014:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2015:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2074:Sash1 UTSW 10 8756697 missense probably damaging 1.00
R2252:Sash1 UTSW 10 8729977 missense probably benign 0.01
R2253:Sash1 UTSW 10 8729977 missense probably benign 0.01
R2260:Sash1 UTSW 10 8786378 nonsense probably null
R3085:Sash1 UTSW 10 8742422 splice site probably null
R4024:Sash1 UTSW 10 8729917 missense probably benign 0.00
R4039:Sash1 UTSW 10 8729627 missense probably damaging 1.00
R4290:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4292:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4295:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4657:Sash1 UTSW 10 8725660 missense probably damaging 1.00
R4669:Sash1 UTSW 10 8730385 missense probably benign 0.00
R4719:Sash1 UTSW 10 8729713 missense probably benign 0.01
R4745:Sash1 UTSW 10 8729908 missense probably benign
R5197:Sash1 UTSW 10 8740225 missense probably damaging 1.00
R5217:Sash1 UTSW 10 8780604 missense possibly damaging 0.63
R5420:Sash1 UTSW 10 8746186 missense probably damaging 1.00
R5591:Sash1 UTSW 10 8725718 missense probably benign 0.36
R6505:Sash1 UTSW 10 8729527 missense probably benign 0.21
R6679:Sash1 UTSW 10 8740185 missense probably damaging 1.00
R6761:Sash1 UTSW 10 8744522 missense probably damaging 0.99
R6885:Sash1 UTSW 10 8784221 missense probably damaging 1.00
R6980:Sash1 UTSW 10 8729848 missense probably benign 0.00
R7034:Sash1 UTSW 10 8730083 nonsense probably null
R7036:Sash1 UTSW 10 8730083 nonsense probably null
R7088:Sash1 UTSW 10 8729717 nonsense probably null
R7289:Sash1 UTSW 10 8730196 missense probably damaging 0.99
R7464:Sash1 UTSW 10 8756745 missense possibly damaging 0.82
R7661:Sash1 UTSW 10 8729391 missense probably benign 0.01
R7752:Sash1 UTSW 10 8780564 nonsense probably null
R7856:Sash1 UTSW 10 8729708 missense probably benign 0.00
R7901:Sash1 UTSW 10 8780564 nonsense probably null
R8152:Sash1 UTSW 10 8751041 missense possibly damaging 0.94
R8218:Sash1 UTSW 10 8751236 missense probably damaging 0.99
R8317:Sash1 UTSW 10 8729386 missense possibly damaging 0.76
R8358:Sash1 UTSW 10 8729981 missense probably benign
R8503:Sash1 UTSW 10 8780513 splice site probably benign
R8696:Sash1 UTSW 10 8733695 missense probably damaging 1.00
R8703:Sash1 UTSW 10 8729831 missense probably damaging 0.99
R8710:Sash1 UTSW 10 8780521 missense possibly damaging 0.82
R8822:Sash1 UTSW 10 8885871 start gained probably benign
R8826:Sash1 UTSW 10 8762105 start codon destroyed probably null
R8891:Sash1 UTSW 10 8727970 missense probably damaging 1.00
R8968:Sash1 UTSW 10 8730415 missense probably benign 0.00
R8984:Sash1 UTSW 10 8751044 missense possibly damaging 0.46
R9194:Sash1 UTSW 10 8740205 missense probably damaging 0.99
R9248:Sash1 UTSW 10 8741532 missense probably damaging 1.00
R9405:Sash1 UTSW 10 8762230 start gained probably benign
R9408:Sash1 UTSW 10 8762230 start gained probably benign
R9489:Sash1 UTSW 10 8729405 missense probably benign 0.05
R9576:Sash1 UTSW 10 8744535 missense probably benign 0.06
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2015-06-20