Mutagenetix > Incidental Mutation

Incidental Mutation 'R4301:Sash1'

322418

Institutional Source

Beutler Lab

Gene Symbol

Sash1

Ensembl Gene

ENSMUSG00000015305

Gene Name

SAM and SH3 domain containing 1

Synonyms

A330076K04Rik, 2500002E12Rik, 1100001C18Rik

MMRRC Submission

041088-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4301 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

8597983-8761814 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 8627234 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 50 (V50A)

Ref Sequence

ENSEMBL: ENSMUSP00000148780 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015449] [ENSMUST00000212553] [ENSMUST00000212869]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000015449
AA Change: V286A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000015449
Gene: ENSMUSG00000015305
AA Change: V286A

Domain	Start	End	E-Value	Type
low complexity region	2	21	N/A	INTRINSIC
coiled coil region	185	212	N/A	INTRINSIC
low complexity region	323	336	N/A	INTRINSIC
Pfam:SLY	394	548	1.2e-46	PFAM
SH3	550	607	1.16e-3	SMART
SAM	623	690	1.83e-11	SMART
low complexity region	1008	1021	N/A	INTRINSIC
SAM	1157	1224	3.6e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000212553
AA Change: V54A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000212869
AA Change: V50A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Meta Mutation Damage Score

0.0621

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein involved in the TLR4 signaling pathway that may stimulate cytokine production and endothelial cell migration in response to invading pathogens. The encoded protein has also been described as a potential tumor suppressor that may negatively regulate proliferation, apoptosis, and invasion of cancer cells, and reduced expression of this gene has been observed in multiple human cancers. Mutations in this gene may be associated with abnormal skin pigmentation in human patients. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3bp	T	A	16: 56,377,266 (GRCm39)	V95D	probably damaging	Het
Adamtsl2	A	G	2: 26,977,295 (GRCm39)	D252G	probably null	Het
Adgra3	T	C	5: 50,118,420 (GRCm39)	R1043G	possibly damaging	Het
Atxn7l1	A	G	12: 33,417,237 (GRCm39)	D562G	probably damaging	Het
Ccdc70	T	C	8: 22,463,228 (GRCm39)	V6A	possibly damaging	Het
Cdc25a	T	C	9: 109,718,810 (GRCm39)	V337A	probably benign	Het
Chil4	G	A	3: 106,111,043 (GRCm39)	P284S	possibly damaging	Het
Crb1	A	G	1: 139,176,568 (GRCm39)	S472P	probably benign	Het
Fam193b	G	A	13: 55,690,417 (GRCm39)	R740*	probably null	Het
Fer	G	T	17: 64,385,905 (GRCm39)	L292F	probably damaging	Het
Gmppa	G	A	1: 75,419,140 (GRCm39)	R349H	possibly damaging	Het
Hspa1a	T	C	17: 35,189,482 (GRCm39)	I474V	probably benign	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 53,032,934 (GRCm39)	74	probably benign	Het
Lrrc30	A	G	17: 67,939,563 (GRCm39)	S6P	probably damaging	Het
Lzts3	A	G	2: 130,478,358 (GRCm39)	S133P	probably damaging	Het
Mrtfb	T	C	16: 13,216,169 (GRCm39)	Y294H	probably damaging	Het
Mtmr12	T	A	15: 12,236,106 (GRCm39)	F122I	possibly damaging	Het
Mypn	A	G	10: 62,954,263 (GRCm39)	Y124H	probably damaging	Het
Nfat5	T	C	8: 108,082,327 (GRCm39)		probably benign	Het
Npr2	T	C	4: 43,641,332 (GRCm39)		probably null	Het
Or5a3	T	C	19: 12,400,081 (GRCm39)	L136P	probably damaging	Het
Pgm2	G	A	5: 64,261,140 (GRCm39)	W51*	probably null	Het
Phip	G	A	9: 82,841,766 (GRCm39)	R48*	probably null	Het
Piezo2	T	C	18: 63,217,911 (GRCm39)	T1075A	probably damaging	Het
Ppat	G	T	5: 77,076,348 (GRCm39)		probably benign	Het
Ppp2r2b	T	A	18: 43,031,811 (GRCm39)	E23D	probably null	Het
Prickle1	T	C	15: 93,406,517 (GRCm39)	I169V	possibly damaging	Het
Rab37	T	A	11: 115,049,390 (GRCm39)	D95E	possibly damaging	Het
Siae	C	A	9: 37,545,009 (GRCm39)	Q335K	possibly damaging	Het
Snx14	A	T	9: 88,292,676 (GRCm39)	I217K	probably damaging	Het
Son	A	G	16: 91,455,299 (GRCm39)	T1349A	possibly damaging	Het
Sptb	A	G	12: 76,659,471 (GRCm39)	L1143S	probably damaging	Het
Trim80	T	C	11: 115,335,939 (GRCm39)		probably null	Het
Trpm3	T	C	19: 22,964,656 (GRCm39)	S1374P	probably benign	Het
Vldlr	C	A	19: 27,215,802 (GRCm39)	D266E	possibly damaging	Het
Vmn2r79	A	G	7: 86,651,099 (GRCm39)	H166R	possibly damaging	Het
Zbtb10	A	T	3: 9,330,220 (GRCm39)	Q526L	probably damaging	Het
Zfr2	T	C	10: 81,078,018 (GRCm39)		probably benign	Het
Zswim8	G	A	14: 20,763,977 (GRCm39)	R449H	possibly damaging	Het
Zzef1	T	C	11: 72,779,861 (GRCm39)	V1878A	probably damaging	Het

Other mutations in Sash1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00987:Sash1	APN	10	8,627,177 (GRCm39)	missense	probably damaging	1.00
IGL01535:Sash1	APN	10	8,617,341 (GRCm39)	missense	probably damaging	1.00
IGL01537:Sash1	APN	10	8,605,422 (GRCm39)	missense	probably damaging	1.00
IGL01788:Sash1	APN	10	8,609,410 (GRCm39)	missense	probably benign	0.01
IGL01933:Sash1	APN	10	8,626,897 (GRCm39)	missense	probably damaging	0.99
IGL02126:Sash1	APN	10	8,615,229 (GRCm39)	missense	probably damaging	0.96
IGL02285:Sash1	APN	10	8,616,098 (GRCm39)	missense	probably damaging	0.99
IGL02400:Sash1	APN	10	8,609,411 (GRCm39)	nonsense	probably null
IGL02504:Sash1	APN	10	8,605,676 (GRCm39)	missense	probably benign	0.00
IGL02630:Sash1	APN	10	8,620,299 (GRCm39)	missense	probably benign	0.06
boyscout	UTSW	10	8,618,186 (GRCm39)	splice site	probably null
cubscout	UTSW	10	8,605,477 (GRCm39)	missense	probably benign	0.01
R0592:Sash1	UTSW	10	8,605,546 (GRCm39)	missense	probably benign	0.00
R0647:Sash1	UTSW	10	8,605,316 (GRCm39)	missense	probably damaging	0.99
R0656:Sash1	UTSW	10	8,626,901 (GRCm39)	critical splice donor site	probably null
R0830:Sash1	UTSW	10	8,605,673 (GRCm39)	missense	probably benign	0.01
R0919:Sash1	UTSW	10	8,605,843 (GRCm39)	missense	probably benign	0.01
R1470:Sash1	UTSW	10	8,665,357 (GRCm39)	missense	probably damaging	1.00
R1470:Sash1	UTSW	10	8,665,357 (GRCm39)	missense	probably damaging	1.00
R1606:Sash1	UTSW	10	8,605,721 (GRCm39)	missense	probably benign	0.00
R1707:Sash1	UTSW	10	8,606,141 (GRCm39)	missense	probably benign	0.00
R1922:Sash1	UTSW	10	8,603,672 (GRCm39)	missense	possibly damaging	0.62
R1940:Sash1	UTSW	10	8,605,696 (GRCm39)	missense	probably benign
R1964:Sash1	UTSW	10	8,605,477 (GRCm39)	missense	probably benign	0.01
R2013:Sash1	UTSW	10	8,605,177 (GRCm39)	missense	probably benign	0.03
R2014:Sash1	UTSW	10	8,605,177 (GRCm39)	missense	probably benign	0.03
R2015:Sash1	UTSW	10	8,605,177 (GRCm39)	missense	probably benign	0.03
R2074:Sash1	UTSW	10	8,632,461 (GRCm39)	missense	probably damaging	1.00
R2252:Sash1	UTSW	10	8,605,741 (GRCm39)	missense	probably benign	0.01
R2253:Sash1	UTSW	10	8,605,741 (GRCm39)	missense	probably benign	0.01
R2260:Sash1	UTSW	10	8,662,142 (GRCm39)	nonsense	probably null
R3085:Sash1	UTSW	10	8,618,186 (GRCm39)	splice site	probably null
R4024:Sash1	UTSW	10	8,605,681 (GRCm39)	missense	probably benign	0.00
R4039:Sash1	UTSW	10	8,605,391 (GRCm39)	missense	probably damaging	1.00
R4290:Sash1	UTSW	10	8,606,006 (GRCm39)	missense	possibly damaging	0.59
R4292:Sash1	UTSW	10	8,606,006 (GRCm39)	missense	possibly damaging	0.59
R4295:Sash1	UTSW	10	8,606,006 (GRCm39)	missense	possibly damaging	0.59
R4657:Sash1	UTSW	10	8,601,424 (GRCm39)	missense	probably damaging	1.00
R4669:Sash1	UTSW	10	8,606,149 (GRCm39)	missense	probably benign	0.00
R4719:Sash1	UTSW	10	8,605,477 (GRCm39)	missense	probably benign	0.01
R4745:Sash1	UTSW	10	8,605,672 (GRCm39)	missense	probably benign
R5197:Sash1	UTSW	10	8,615,989 (GRCm39)	missense	probably damaging	1.00
R5217:Sash1	UTSW	10	8,656,368 (GRCm39)	missense	possibly damaging	0.63
R5420:Sash1	UTSW	10	8,621,950 (GRCm39)	missense	probably damaging	1.00
R5591:Sash1	UTSW	10	8,601,482 (GRCm39)	missense	probably benign	0.36
R6505:Sash1	UTSW	10	8,605,291 (GRCm39)	missense	probably benign	0.21
R6679:Sash1	UTSW	10	8,615,949 (GRCm39)	missense	probably damaging	1.00
R6761:Sash1	UTSW	10	8,620,286 (GRCm39)	missense	probably damaging	0.99
R6885:Sash1	UTSW	10	8,659,985 (GRCm39)	missense	probably damaging	1.00
R6980:Sash1	UTSW	10	8,605,612 (GRCm39)	missense	probably benign	0.00
R7034:Sash1	UTSW	10	8,605,847 (GRCm39)	nonsense	probably null
R7036:Sash1	UTSW	10	8,605,847 (GRCm39)	nonsense	probably null
R7088:Sash1	UTSW	10	8,605,481 (GRCm39)	nonsense	probably null
R7289:Sash1	UTSW	10	8,605,960 (GRCm39)	missense	probably damaging	0.99
R7464:Sash1	UTSW	10	8,632,509 (GRCm39)	missense	possibly damaging	0.82
R7661:Sash1	UTSW	10	8,605,155 (GRCm39)	missense	probably benign	0.01
R7752:Sash1	UTSW	10	8,656,328 (GRCm39)	nonsense	probably null
R7856:Sash1	UTSW	10	8,605,472 (GRCm39)	missense	probably benign	0.00
R7901:Sash1	UTSW	10	8,656,328 (GRCm39)	nonsense	probably null
R8152:Sash1	UTSW	10	8,626,805 (GRCm39)	missense	possibly damaging	0.94
R8218:Sash1	UTSW	10	8,627,000 (GRCm39)	missense	probably damaging	0.99
R8317:Sash1	UTSW	10	8,605,150 (GRCm39)	missense	possibly damaging	0.76
R8358:Sash1	UTSW	10	8,605,745 (GRCm39)	missense	probably benign
R8503:Sash1	UTSW	10	8,656,277 (GRCm39)	splice site	probably benign
R8696:Sash1	UTSW	10	8,609,459 (GRCm39)	missense	probably damaging	1.00
R8703:Sash1	UTSW	10	8,605,595 (GRCm39)	missense	probably damaging	0.99
R8710:Sash1	UTSW	10	8,656,285 (GRCm39)	missense	possibly damaging	0.82
R8822:Sash1	UTSW	10	8,761,615 (GRCm39)	start gained	probably benign
R8826:Sash1	UTSW	10	8,637,869 (GRCm39)	start codon destroyed	probably null
R8891:Sash1	UTSW	10	8,603,734 (GRCm39)	missense	probably damaging	1.00
R8968:Sash1	UTSW	10	8,606,179 (GRCm39)	missense	probably benign	0.00
R8984:Sash1	UTSW	10	8,626,808 (GRCm39)	missense	possibly damaging	0.46
R9194:Sash1	UTSW	10	8,615,969 (GRCm39)	missense	probably damaging	0.99
R9248:Sash1	UTSW	10	8,617,296 (GRCm39)	missense	probably damaging	1.00
R9405:Sash1	UTSW	10	8,637,994 (GRCm39)	start gained	probably benign
R9408:Sash1	UTSW	10	8,637,994 (GRCm39)	start gained	probably benign
R9489:Sash1	UTSW	10	8,605,169 (GRCm39)	missense	probably benign	0.05
R9576:Sash1	UTSW	10	8,620,299 (GRCm39)	missense	probably benign	0.06
R9632:Sash1	UTSW	10	8,615,969 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCCCCATCTTCTTAGGGG -3'
(R):5'- CATTGACCTGCAAGTCATGTTTATG -3'

Sequencing Primer
(F):5'- GAAGGTTTTGACCAACTTCCGGC -3'
(R):5'- CCTGCAAGTCATGTTTATGAAGAAG -3'

Posted On

2015-06-20