Incidental Mutation 'R4301:Zfr2'
ID322420
Institutional Source Beutler Lab
Gene Symbol Zfr2
Ensembl Gene ENSMUSG00000034949
Gene Namezinc finger RNA binding protein 2
Synonyms9130206N08Rik, 2010013I23Rik
MMRRC Submission 041088-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R4301 (G1)
Quality Score127
Status Validated
Chromosome10
Chromosomal Location81233155-81252123 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 81242184 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117798] [ENSMUST00000144087]
Predicted Effect probably benign
Transcript: ENSMUST00000117798
SMART Domains Protein: ENSMUSP00000113913
Gene: ENSMUSG00000034949

DomainStartEndE-ValueType
low complexity region 16 23 N/A INTRINSIC
low complexity region 44 62 N/A INTRINSIC
low complexity region 123 163 N/A INTRINSIC
ZnF_U1 202 236 3.58e-5 SMART
ZnF_C2H2 205 229 7.68e0 SMART
ZnF_U1 249 283 3.78e-4 SMART
ZnF_C2H2 252 276 4.12e0 SMART
ZnF_U1 397 431 3.78e-4 SMART
ZnF_C2H2 400 424 1.99e0 SMART
low complexity region 484 508 N/A INTRINSIC
DZF 585 837 2.06e-129 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127526
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132174
Predicted Effect probably benign
Transcript: ENSMUST00000144087
SMART Domains Protein: ENSMUSP00000115001
Gene: ENSMUSG00000034949

DomainStartEndE-ValueType
low complexity region 33 51 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T A 16: 56,556,903 V95D probably damaging Het
Adamtsl2 A G 2: 27,087,283 D252G probably null Het
Adgra3 T C 5: 49,961,078 R1043G possibly damaging Het
Atxn7l1 A G 12: 33,367,238 D562G probably damaging Het
Ccdc70 T C 8: 21,973,212 V6A possibly damaging Het
Cdc25a T C 9: 109,889,742 V337A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Crb1 A G 1: 139,248,830 S472P probably benign Het
Fam193b G A 13: 55,542,604 R740* probably null Het
Fer G T 17: 64,078,910 L292F probably damaging Het
Gmppa G A 1: 75,442,496 R349H possibly damaging Het
Hspa1a T C 17: 34,970,506 I474V probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc30 A G 17: 67,632,568 S6P probably damaging Het
Lzts3 A G 2: 130,636,438 S133P probably damaging Het
Mkl2 T C 16: 13,398,305 Y294H probably damaging Het
Mtmr12 T A 15: 12,236,020 F122I possibly damaging Het
Mypn A G 10: 63,118,484 Y124H probably damaging Het
Nfat5 T C 8: 107,355,695 probably benign Het
Npr2 T C 4: 43,641,332 probably null Het
Olfr1441 T C 19: 12,422,717 L136P probably damaging Het
Pgm1 G A 5: 64,103,797 W51* probably null Het
Phip G A 9: 82,959,713 R48* probably null Het
Piezo2 T C 18: 63,084,840 T1075A probably damaging Het
Ppat G T 5: 76,928,501 probably benign Het
Ppp2r2b T A 18: 42,898,746 E23D probably null Het
Prickle1 T C 15: 93,508,636 I169V possibly damaging Het
Rab37 T A 11: 115,158,564 D95E possibly damaging Het
Sash1 A G 10: 8,751,470 V50A probably benign Het
Siae C A 9: 37,633,713 Q335K possibly damaging Het
Snx14 A T 9: 88,410,623 I217K probably damaging Het
Son A G 16: 91,658,411 T1349A possibly damaging Het
Sptb A G 12: 76,612,697 L1143S probably damaging Het
Trim80 T C 11: 115,445,113 probably null Het
Trpm3 T C 19: 22,987,292 S1374P probably benign Het
Vldlr C A 19: 27,238,402 D266E possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zbtb10 A T 3: 9,265,160 Q526L probably damaging Het
Zswim8 G A 14: 20,713,909 R449H possibly damaging Het
Zzef1 T C 11: 72,889,035 V1878A probably damaging Het
Other mutations in Zfr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Zfr2 APN 10 81242085 missense probably damaging 0.96
IGL01622:Zfr2 APN 10 81251359 missense probably benign
IGL01623:Zfr2 APN 10 81251359 missense probably benign
IGL02719:Zfr2 APN 10 81244712 missense probably damaging 1.00
IGL03036:Zfr2 APN 10 81242151 missense probably benign 0.01
R0302:Zfr2 UTSW 10 81251336 unclassified probably benign
R0837:Zfr2 UTSW 10 81245408 missense probably damaging 1.00
R1557:Zfr2 UTSW 10 81247391 missense probably benign 0.01
R1714:Zfr2 UTSW 10 81244749 missense probably damaging 1.00
R1737:Zfr2 UTSW 10 81242085 missense probably damaging 0.96
R1991:Zfr2 UTSW 10 81242852 missense possibly damaging 0.86
R2134:Zfr2 UTSW 10 81242901 missense probably damaging 1.00
R2148:Zfr2 UTSW 10 81242116 missense probably benign 0.13
R2150:Zfr2 UTSW 10 81242116 missense probably benign 0.13
R3703:Zfr2 UTSW 10 81246079 missense probably benign 0.40
R3704:Zfr2 UTSW 10 81246079 missense probably benign 0.40
R3705:Zfr2 UTSW 10 81246079 missense probably benign 0.40
R3715:Zfr2 UTSW 10 81246079 missense probably benign 0.40
R4654:Zfr2 UTSW 10 81251249 splice site probably null
R4811:Zfr2 UTSW 10 81243713 missense probably benign 0.07
R5290:Zfr2 UTSW 10 81246710 frame shift probably null
R5781:Zfr2 UTSW 10 81243713 missense probably benign 0.07
R7114:Zfr2 UTSW 10 81244725 missense probably damaging 1.00
R8192:Zfr2 UTSW 10 81242815 missense possibly damaging 0.83
X0063:Zfr2 UTSW 10 81242957 critical splice donor site probably null
Z1177:Zfr2 UTSW 10 81246084 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TATCGGGATCACCTGGAAGG -3'
(R):5'- CAAGCCTGTGAGCAGATGTG -3'

Sequencing Primer
(F):5'- TCACCTGGAAGGGCAGAAGC -3'
(R):5'- CACACTCCTGCCTGCAG -3'
Posted On2015-06-20