Incidental Mutation 'R4301:Zzef1'
ID322421
Institutional Source Beutler Lab
Gene Symbol Zzef1
Ensembl Gene ENSMUSG00000055670
Gene Namezinc finger, ZZ-type with EF hand domain 1
SynonymsC130099L13Rik, 8430405D05Rik
MMRRC Submission 041088-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4301 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location72796226-72927120 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72889035 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1878 (V1878A)
Ref Sequence ENSEMBL: ENSMUSP00000147028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069395] [ENSMUST00000172220] [ENSMUST00000207107]
Predicted Effect probably damaging
Transcript: ENSMUST00000069395
AA Change: V1878A

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000068790
Gene: ENSMUSG00000055670
AA Change: V1878A

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 28 68 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
APC10 246 397 2.65e-48 SMART
internal_repeat_1 1122 1192 1.25e-7 PROSPERO
low complexity region 1472 1485 N/A INTRINSIC
low complexity region 1512 1525 N/A INTRINSIC
ZnF_ZZ 1775 1823 2.54e-7 SMART
ZnF_ZZ 1824 1868 1.2e-8 SMART
low complexity region 1947 1963 N/A INTRINSIC
low complexity region 2127 2140 N/A INTRINSIC
low complexity region 2249 2263 N/A INTRINSIC
internal_repeat_1 2657 2726 1.25e-7 PROSPERO
low complexity region 2840 2853 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172220
AA Change: V1878A

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130515
Gene: ENSMUSG00000055670
AA Change: V1878A

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 28 68 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
APC10 246 397 2.65e-48 SMART
internal_repeat_1 1006 1192 1.57e-16 PROSPERO
low complexity region 1472 1485 N/A INTRINSIC
low complexity region 1512 1525 N/A INTRINSIC
ZnF_ZZ 1775 1823 2.54e-7 SMART
ZnF_ZZ 1824 1868 1.2e-8 SMART
low complexity region 1947 1963 N/A INTRINSIC
low complexity region 2127 2140 N/A INTRINSIC
low complexity region 2249 2263 N/A INTRINSIC
internal_repeat_1 2583 2759 1.57e-16 PROSPERO
low complexity region 2873 2886 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207107
AA Change: V1878A

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.1085 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T A 16: 56,556,903 V95D probably damaging Het
Adamtsl2 A G 2: 27,087,283 D252G probably null Het
Adgra3 T C 5: 49,961,078 R1043G possibly damaging Het
Atxn7l1 A G 12: 33,367,238 D562G probably damaging Het
Ccdc70 T C 8: 21,973,212 V6A possibly damaging Het
Cdc25a T C 9: 109,889,742 V337A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Crb1 A G 1: 139,248,830 S472P probably benign Het
Fam193b G A 13: 55,542,604 R740* probably null Het
Fer G T 17: 64,078,910 L292F probably damaging Het
Gmppa G A 1: 75,442,496 R349H possibly damaging Het
Hspa1a T C 17: 34,970,506 I474V probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc30 A G 17: 67,632,568 S6P probably damaging Het
Lzts3 A G 2: 130,636,438 S133P probably damaging Het
Mkl2 T C 16: 13,398,305 Y294H probably damaging Het
Mtmr12 T A 15: 12,236,020 F122I possibly damaging Het
Mypn A G 10: 63,118,484 Y124H probably damaging Het
Nfat5 T C 8: 107,355,695 probably benign Het
Npr2 T C 4: 43,641,332 probably null Het
Olfr1441 T C 19: 12,422,717 L136P probably damaging Het
Pgm1 G A 5: 64,103,797 W51* probably null Het
Phip G A 9: 82,959,713 R48* probably null Het
Piezo2 T C 18: 63,084,840 T1075A probably damaging Het
Ppat G T 5: 76,928,501 probably benign Het
Ppp2r2b T A 18: 42,898,746 E23D probably null Het
Prickle1 T C 15: 93,508,636 I169V possibly damaging Het
Rab37 T A 11: 115,158,564 D95E possibly damaging Het
Sash1 A G 10: 8,751,470 V50A probably benign Het
Siae C A 9: 37,633,713 Q335K possibly damaging Het
Snx14 A T 9: 88,410,623 I217K probably damaging Het
Son A G 16: 91,658,411 T1349A possibly damaging Het
Sptb A G 12: 76,612,697 L1143S probably damaging Het
Trim80 T C 11: 115,445,113 probably null Het
Trpm3 T C 19: 22,987,292 S1374P probably benign Het
Vldlr C A 19: 27,238,402 D266E possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zbtb10 A T 3: 9,265,160 Q526L probably damaging Het
Zfr2 T C 10: 81,242,184 probably benign Het
Zswim8 G A 14: 20,713,909 R449H possibly damaging Het
Other mutations in Zzef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Zzef1 APN 11 72875126 missense probably benign 0.02
IGL00898:Zzef1 APN 11 72875173 missense probably benign 0.00
IGL00970:Zzef1 APN 11 72915245 missense probably benign 0.06
IGL01062:Zzef1 APN 11 72874969 missense probably benign
IGL01832:Zzef1 APN 11 72875066 missense probably damaging 0.99
IGL02005:Zzef1 APN 11 72888299 missense probably benign 0.00
IGL02026:Zzef1 APN 11 72881338 missense probably benign 0.39
IGL02110:Zzef1 APN 11 72913112 missense probably damaging 1.00
IGL02305:Zzef1 APN 11 72866597 splice site probably benign
IGL02308:Zzef1 APN 11 72886747 missense probably benign 0.04
IGL02315:Zzef1 APN 11 72875257 nonsense probably null
IGL02332:Zzef1 APN 11 72916509 missense probably benign 0.01
IGL02389:Zzef1 APN 11 72891217 missense probably benign
IGL02389:Zzef1 APN 11 72899538 missense possibly damaging 0.89
IGL02451:Zzef1 APN 11 72901388 missense probably damaging 0.99
IGL02541:Zzef1 APN 11 72872649 missense probably damaging 1.00
IGL02950:Zzef1 APN 11 72917699 splice site probably benign
IGL02953:Zzef1 APN 11 72855398 missense probably benign
IGL03053:Zzef1 APN 11 72831539 splice site probably benign
IGL03085:Zzef1 APN 11 72855524 splice site probably benign
IGL03152:Zzef1 APN 11 72923182 critical splice donor site probably null
IGL03329:Zzef1 APN 11 72917273 splice site probably benign
IGL03376:Zzef1 APN 11 72876551 splice site probably benign
IGL03394:Zzef1 APN 11 72886775 splice site probably null
BB005:Zzef1 UTSW 11 72821896 missense probably damaging 0.99
BB015:Zzef1 UTSW 11 72821896 missense probably damaging 0.99
PIT4508001:Zzef1 UTSW 11 72895176 missense probably benign
PIT4581001:Zzef1 UTSW 11 72899672 missense probably benign 0.00
PIT4810001:Zzef1 UTSW 11 72850745 missense probably damaging 1.00
R0094:Zzef1 UTSW 11 72817965 missense probably benign 0.01
R0119:Zzef1 UTSW 11 72821851 missense probably benign
R0136:Zzef1 UTSW 11 72821851 missense probably benign
R0140:Zzef1 UTSW 11 72899551 missense possibly damaging 0.70
R0212:Zzef1 UTSW 11 72873910 missense possibly damaging 0.66
R0217:Zzef1 UTSW 11 72889068 missense probably damaging 1.00
R0220:Zzef1 UTSW 11 72865966 missense probably damaging 1.00
R0304:Zzef1 UTSW 11 72880624 missense probably benign 0.10
R0400:Zzef1 UTSW 11 72895242 missense probably damaging 1.00
R0422:Zzef1 UTSW 11 72866091 missense possibly damaging 0.93
R0471:Zzef1 UTSW 11 72923111 missense probably damaging 1.00
R0557:Zzef1 UTSW 11 72917730 missense probably damaging 1.00
R0581:Zzef1 UTSW 11 72851900 missense probably benign 0.00
R0599:Zzef1 UTSW 11 72913178 missense probably damaging 1.00
R0603:Zzef1 UTSW 11 72818069 missense probably benign 0.00
R0657:Zzef1 UTSW 11 72821851 missense probably benign
R0987:Zzef1 UTSW 11 72901333 small deletion probably benign
R1246:Zzef1 UTSW 11 72874909 missense probably benign 0.00
R1327:Zzef1 UTSW 11 72893414 critical splice donor site probably null
R1438:Zzef1 UTSW 11 72912945 missense probably damaging 0.96
R1466:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1466:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1485:Zzef1 UTSW 11 72900809 splice site probably null
R1556:Zzef1 UTSW 11 72915233 missense probably damaging 1.00
R1563:Zzef1 UTSW 11 72848733 nonsense probably null
R1584:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1643:Zzef1 UTSW 11 72826202 missense probably damaging 1.00
R1646:Zzef1 UTSW 11 72864036 critical splice donor site probably null
R1764:Zzef1 UTSW 11 72893332 missense probably benign 0.00
R1777:Zzef1 UTSW 11 72910272 missense probably damaging 1.00
R1793:Zzef1 UTSW 11 72886709 missense probably damaging 1.00
R1900:Zzef1 UTSW 11 72848714 missense probably damaging 0.99
R2096:Zzef1 UTSW 11 72872639 missense probably benign 0.02
R2134:Zzef1 UTSW 11 72880624 missense probably benign 0.02
R2157:Zzef1 UTSW 11 72848634 splice site probably benign
R2183:Zzef1 UTSW 11 72886718 nonsense probably null
R2192:Zzef1 UTSW 11 72910156 synonymous probably null
R2230:Zzef1 UTSW 11 72884416 missense probably damaging 0.99
R2259:Zzef1 UTSW 11 72900633 nonsense probably null
R2384:Zzef1 UTSW 11 72858394 missense probably damaging 0.99
R2426:Zzef1 UTSW 11 72915265 missense probably benign 0.01
R2915:Zzef1 UTSW 11 72910326 splice site probably null
R3700:Zzef1 UTSW 11 72886772 missense probably null 1.00
R3875:Zzef1 UTSW 11 72889040 missense probably benign 0.22
R3902:Zzef1 UTSW 11 72908500 missense probably damaging 1.00
R3927:Zzef1 UTSW 11 72858382 missense probably damaging 1.00
R4086:Zzef1 UTSW 11 72875053 missense probably benign 0.02
R4359:Zzef1 UTSW 11 72823508 missense probably damaging 0.98
R4382:Zzef1 UTSW 11 72875112 missense probably benign 0.00
R4453:Zzef1 UTSW 11 72872639 missense probably benign 0.02
R4466:Zzef1 UTSW 11 72924659 missense probably damaging 1.00
R4471:Zzef1 UTSW 11 72913331 missense probably damaging 1.00
R4510:Zzef1 UTSW 11 72888170 missense probably benign 0.32
R4511:Zzef1 UTSW 11 72888170 missense probably benign 0.32
R4714:Zzef1 UTSW 11 72837212 missense probably damaging 1.00
R4799:Zzef1 UTSW 11 72859623 missense probably benign 0.12
R4906:Zzef1 UTSW 11 72901388 missense probably damaging 1.00
R5075:Zzef1 UTSW 11 72858344 missense probably damaging 1.00
R5357:Zzef1 UTSW 11 72843333 nonsense probably null
R5579:Zzef1 UTSW 11 72900637 missense probably damaging 0.98
R5598:Zzef1 UTSW 11 72916521 missense probably damaging 1.00
R5725:Zzef1 UTSW 11 72855482 missense possibly damaging 0.86
R5765:Zzef1 UTSW 11 72821937 nonsense probably null
R5928:Zzef1 UTSW 11 72912852 missense probably damaging 1.00
R6003:Zzef1 UTSW 11 72824065 splice site probably null
R6047:Zzef1 UTSW 11 72866095 missense probably damaging 0.99
R6224:Zzef1 UTSW 11 72855383 missense probably damaging 0.99
R6225:Zzef1 UTSW 11 72869805 missense possibly damaging 0.62
R6287:Zzef1 UTSW 11 72923112 missense probably damaging 1.00
R6361:Zzef1 UTSW 11 72884349 missense possibly damaging 0.93
R6451:Zzef1 UTSW 11 72923156 missense possibly damaging 0.88
R6467:Zzef1 UTSW 11 72911264 critical splice donor site probably null
R6484:Zzef1 UTSW 11 72895271 missense probably damaging 1.00
R6493:Zzef1 UTSW 11 72913303 missense probably benign 0.06
R6520:Zzef1 UTSW 11 72826065 missense probably damaging 1.00
R6527:Zzef1 UTSW 11 72874990 missense probably benign 0.00
R6540:Zzef1 UTSW 11 72913229 missense probably damaging 1.00
R6608:Zzef1 UTSW 11 72912826 missense probably damaging 1.00
R6795:Zzef1 UTSW 11 72850659 missense probably benign 0.00
R6927:Zzef1 UTSW 11 72913157 missense probably damaging 1.00
R6987:Zzef1 UTSW 11 72855514 missense possibly damaging 0.89
R7048:Zzef1 UTSW 11 72866699 nonsense probably null
R7076:Zzef1 UTSW 11 72899559 missense probably benign 0.00
R7099:Zzef1 UTSW 11 72872649 missense possibly damaging 0.92
R7132:Zzef1 UTSW 11 72917871 critical splice donor site probably null
R7175:Zzef1 UTSW 11 72851901 missense possibly damaging 0.49
R7284:Zzef1 UTSW 11 72886690 missense probably damaging 0.99
R7300:Zzef1 UTSW 11 72875004 missense probably benign 0.02
R7486:Zzef1 UTSW 11 72864786 missense possibly damaging 0.85
R7503:Zzef1 UTSW 11 72826067 missense probably damaging 1.00
R7679:Zzef1 UTSW 11 72893278 missense probably benign
R7874:Zzef1 UTSW 11 72859653 missense probably benign 0.01
R7898:Zzef1 UTSW 11 72796547 missense probably damaging 1.00
R7928:Zzef1 UTSW 11 72821896 missense probably damaging 0.99
R8021:Zzef1 UTSW 11 72823416 missense probably damaging 0.99
R8145:Zzef1 UTSW 11 72908469 nonsense probably null
R8255:Zzef1 UTSW 11 72875129 missense probably benign 0.00
R8303:Zzef1 UTSW 11 72917189 missense probably damaging 1.00
X0028:Zzef1 UTSW 11 72906979 missense probably benign 0.29
Z1176:Zzef1 UTSW 11 72796528 missense probably damaging 1.00
Z1177:Zzef1 UTSW 11 72796312 missense possibly damaging 0.91
Z1177:Zzef1 UTSW 11 72826178 missense probably damaging 1.00
Z1177:Zzef1 UTSW 11 72900631 critical splice acceptor site probably null
Z1177:Zzef1 UTSW 11 72915320 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAACTCTCTTCCTCGGCATG -3'
(R):5'- AATAGTCACCTTTGCCCTGG -3'

Sequencing Primer
(F):5'- CATGGTTTTCATGTGCAGGCATTAG -3'
(R):5'- TGGGCCTTCATCAGACAGTC -3'
Posted On2015-06-20