Mutagenetix > Incidental Mutation

Incidental Mutation 'R4301:Atxn7l1'

322424

Institutional Source

Beutler Lab

Gene Symbol

Atxn7l1

Ensembl Gene

ENSMUSG00000020564

Gene Name

ataxin 7-like 1

Synonyms

Atxn7l4, 2810423G08Rik

MMRRC Submission

041088-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.103) question?

Stock #

R4301 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

33147693-33373185 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 33367238 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 562 (D562G)

Ref Sequence

ENSEMBL: ENSMUSP00000118777 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090597] [ENSMUST00000125192] [ENSMUST00000146040] [ENSMUST00000154742]

AlphaFold

Q9CZ05

Predicted Effect

probably damaging
Transcript: ENSMUST00000090597
AA Change: D466G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000088085
Gene: ENSMUSG00000020564
AA Change: D466G

Domain	Start	End	E-Value	Type
low complexity region	4	13	N/A	INTRINSIC
low complexity region	95	110	N/A	INTRINSIC
Pfam:SCA7	143	220	2.5e-31	PFAM
low complexity region	274	288	N/A	INTRINSIC
low complexity region	380	392	N/A	INTRINSIC
low complexity region	471	501	N/A	INTRINSIC
low complexity region	519	538	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000125192
AA Change: D562G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118777
Gene: ENSMUSG00000020564
AA Change: D562G

Domain	Start	End	E-Value	Type
low complexity region	95	114	N/A	INTRINSIC
low complexity region	191	206	N/A	INTRINSIC
Pfam:SCA7	246	314	2e-28	PFAM
low complexity region	370	384	N/A	INTRINSIC
low complexity region	476	488	N/A	INTRINSIC
low complexity region	567	597	N/A	INTRINSIC
low complexity region	615	634	N/A	INTRINSIC
low complexity region	792	810	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126275

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138617

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142184

SMART Domains

Protein: ENSMUSP00000116081
Gene: ENSMUSG00000020564

Domain	Start	End	E-Value	Type
low complexity region	25	44	N/A	INTRINSIC
low complexity region	110	128	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000146040
AA Change: D664G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000122156
Gene: ENSMUSG00000020564
AA Change: D664G

Domain	Start	End	E-Value	Type
low complexity region	95	114	N/A	INTRINSIC
low complexity region	191	206	N/A	INTRINSIC
Pfam:SCA7	246	314	2.3e-28	PFAM
low complexity region	370	384	N/A	INTRINSIC
low complexity region	526	540	N/A	INTRINSIC
low complexity region	578	590	N/A	INTRINSIC
low complexity region	669	699	N/A	INTRINSIC
low complexity region	717	736	N/A	INTRINSIC
low complexity region	894	912	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000154742
AA Change: D466G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000122982
Gene: ENSMUSG00000020564
AA Change: D466G

Domain	Start	End	E-Value	Type
low complexity region	4	13	N/A	INTRINSIC
low complexity region	95	110	N/A	INTRINSIC
Pfam:SCA7	150	218	1.3e-31	PFAM
low complexity region	274	288	N/A	INTRINSIC
low complexity region	380	392	N/A	INTRINSIC
low complexity region	471	501	N/A	INTRINSIC
low complexity region	519	538	N/A	INTRINSIC
low complexity region	696	714	N/A	INTRINSIC

Meta Mutation Damage Score

0.0661

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (43/43)

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3bp	T	A	16: 56,556,903	V95D	probably damaging	Het
Adamtsl2	A	G	2: 27,087,283	D252G	probably null	Het
Adgra3	T	C	5: 49,961,078	R1043G	possibly damaging	Het
Ccdc70	T	C	8: 21,973,212	V6A	possibly damaging	Het
Cdc25a	T	C	9: 109,889,742	V337A	probably benign	Het
Chil4	G	A	3: 106,203,727	P284S	possibly damaging	Het
Crb1	A	G	1: 139,248,830	S472P	probably benign	Het
Fam193b	G	A	13: 55,542,604	R740*	probably null	Het
Fer	G	T	17: 64,078,910	L292F	probably damaging	Het
Gmppa	G	A	1: 75,442,496	R349H	possibly damaging	Het
Hspa1a	T	C	17: 34,970,506	I474V	probably benign	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906	74	probably benign	Het
Lrrc30	A	G	17: 67,632,568	S6P	probably damaging	Het
Lzts3	A	G	2: 130,636,438	S133P	probably damaging	Het
Mkl2	T	C	16: 13,398,305	Y294H	probably damaging	Het
Mtmr12	T	A	15: 12,236,020	F122I	possibly damaging	Het
Mypn	A	G	10: 63,118,484	Y124H	probably damaging	Het
Nfat5	T	C	8: 107,355,695		probably benign	Het
Npr2	T	C	4: 43,641,332		probably null	Het
Olfr1441	T	C	19: 12,422,717	L136P	probably damaging	Het
Pgm1	G	A	5: 64,103,797	W51*	probably null	Het
Phip	G	A	9: 82,959,713	R48*	probably null	Het
Piezo2	T	C	18: 63,084,840	T1075A	probably damaging	Het
Ppat	G	T	5: 76,928,501		probably benign	Het
Ppp2r2b	T	A	18: 42,898,746	E23D	probably null	Het
Prickle1	T	C	15: 93,508,636	I169V	possibly damaging	Het
Rab37	T	A	11: 115,158,564	D95E	possibly damaging	Het
Sash1	A	G	10: 8,751,470	V50A	probably benign	Het
Siae	C	A	9: 37,633,713	Q335K	possibly damaging	Het
Snx14	A	T	9: 88,410,623	I217K	probably damaging	Het
Son	A	G	16: 91,658,411	T1349A	possibly damaging	Het
Sptb	A	G	12: 76,612,697	L1143S	probably damaging	Het
Trim80	T	C	11: 115,445,113		probably null	Het
Trpm3	T	C	19: 22,987,292	S1374P	probably benign	Het
Vldlr	C	A	19: 27,238,402	D266E	possibly damaging	Het
Vmn2r79	A	G	7: 87,001,891	H166R	possibly damaging	Het
Zbtb10	A	T	3: 9,265,160	Q526L	probably damaging	Het
Zfr2	T	C	10: 81,242,184		probably benign	Het
Zswim8	G	A	14: 20,713,909	R449H	possibly damaging	Het
Zzef1	T	C	11: 72,889,035	V1878A	probably damaging	Het

Other mutations in Atxn7l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02130:Atxn7l1	APN	12	33342142	missense	probably damaging	1.00
IGL02146:Atxn7l1	APN	12	33368031	missense	probably benign
IGL02202:Atxn7l1	APN	12	33342078	missense	probably benign	0.05
IGL02804:Atxn7l1	APN	12	33367789	missense	probably damaging	1.00
IGL03344:Atxn7l1	APN	12	33326066	missense	probably damaging	1.00
R0270:Atxn7l1	UTSW	12	33342151	missense	possibly damaging	0.58
R0621:Atxn7l1	UTSW	12	33326100	missense	probably benign	0.15
R1840:Atxn7l1	UTSW	12	33371033	splice site	probably null
R1856:Atxn7l1	UTSW	12	33358770	missense	probably damaging	1.00
R1992:Atxn7l1	UTSW	12	33358744	missense	probably damaging	1.00
R1993:Atxn7l1	UTSW	12	33345977	missense	probably benign
R2249:Atxn7l1	UTSW	12	33358840	missense	probably damaging	1.00
R2369:Atxn7l1	UTSW	12	33358850	critical splice donor site	probably null
R3695:Atxn7l1	UTSW	12	33358697	missense	probably damaging	1.00
R3856:Atxn7l1	UTSW	12	33367600	missense	probably damaging	1.00
R3976:Atxn7l1	UTSW	12	33325955	missense	probably damaging	1.00
R4151:Atxn7l1	UTSW	12	33364482	missense	probably damaging	0.96
R4305:Atxn7l1	UTSW	12	33341992	missense	probably damaging	0.99
R4411:Atxn7l1	UTSW	12	33194887	intron	probably benign
R4763:Atxn7l1	UTSW	12	33358878	intron	probably benign
R5049:Atxn7l1	UTSW	12	33358687	missense	probably benign	0.00
R5090:Atxn7l1	UTSW	12	33326078	missense	probably damaging	1.00
R5134:Atxn7l1	UTSW	12	33372876	missense	probably damaging	1.00
R5425:Atxn7l1	UTSW	12	33367120	missense	probably damaging	1.00
R6161:Atxn7l1	UTSW	12	33358663	missense	possibly damaging	0.62
R6813:Atxn7l1	UTSW	12	33367124	missense	probably damaging	0.96
R7248:Atxn7l1	UTSW	12	33367195	missense	probably benign	0.26
R7328:Atxn7l1	UTSW	12	33148503	critical splice donor site	probably null
R8020:Atxn7l1	UTSW	12	33325953	missense	probably benign	0.10
R8057:Atxn7l1	UTSW	12	33326002	missense	probably damaging	0.99
R8353:Atxn7l1	UTSW	12	33147883	missense	probably damaging	0.99
R8523:Atxn7l1	UTSW	12	33346024	missense	probably benign
R9051:Atxn7l1	UTSW	12	33367421	missense	probably benign	0.00
R9350:Atxn7l1	UTSW	12	33367316	missense	probably benign	0.01
Z1176:Atxn7l1	UTSW	12	33367645	missense	probably benign	0.00
Z1176:Atxn7l1	UTSW	12	33368017	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AACCCCAGTGCTGTGTATC -3'
(R):5'- TTTGTGGGGCCCTGACAATG -3'

Sequencing Primer
(F):5'- AGTGCTGTGTATCTTCCTTCAG -3'
(R):5'- GCCCTGACAATGGAGACG -3'

Posted On

2015-06-20