Incidental Mutation 'R4301:Fam193b'
ID322426
Institutional Source Beutler Lab
Gene Symbol Fam193b
Ensembl Gene ENSMUSG00000021495
Gene Namefamily with sequence similarity 193, member B
SynonymsIRIZIO
MMRRC Submission 041088-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R4301 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location55539316-55571120 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 55542604 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 740 (R740*)
Ref Sequence ENSEMBL: ENSMUSP00000021957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021957] [ENSMUST00000225240]
Predicted Effect probably null
Transcript: ENSMUST00000021957
AA Change: R740*
SMART Domains Protein: ENSMUSP00000021957
Gene: ENSMUSG00000021495
AA Change: R740*

DomainStartEndE-ValueType
low complexity region 55 71 N/A INTRINSIC
low complexity region 133 144 N/A INTRINSIC
low complexity region 161 174 N/A INTRINSIC
low complexity region 198 242 N/A INTRINSIC
low complexity region 260 286 N/A INTRINSIC
coiled coil region 371 404 N/A INTRINSIC
low complexity region 566 573 N/A INTRINSIC
low complexity region 622 635 N/A INTRINSIC
low complexity region 641 657 N/A INTRINSIC
Pfam:FAM193_C 722 776 9.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224486
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224572
Predicted Effect probably benign
Transcript: ENSMUST00000225240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225703
Meta Mutation Damage Score 0.582 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T A 16: 56,556,903 V95D probably damaging Het
Adamtsl2 A G 2: 27,087,283 D252G probably null Het
Adgra3 T C 5: 49,961,078 R1043G possibly damaging Het
Atxn7l1 A G 12: 33,367,238 D562G probably damaging Het
Ccdc70 T C 8: 21,973,212 V6A possibly damaging Het
Cdc25a T C 9: 109,889,742 V337A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Crb1 A G 1: 139,248,830 S472P probably benign Het
Fer G T 17: 64,078,910 L292F probably damaging Het
Gmppa G A 1: 75,442,496 R349H possibly damaging Het
Hspa1a T C 17: 34,970,506 I474V probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc30 A G 17: 67,632,568 S6P probably damaging Het
Lzts3 A G 2: 130,636,438 S133P probably damaging Het
Mkl2 T C 16: 13,398,305 Y294H probably damaging Het
Mtmr12 T A 15: 12,236,020 F122I possibly damaging Het
Mypn A G 10: 63,118,484 Y124H probably damaging Het
Nfat5 T C 8: 107,355,695 probably benign Het
Npr2 T C 4: 43,641,332 probably null Het
Olfr1441 T C 19: 12,422,717 L136P probably damaging Het
Pgm1 G A 5: 64,103,797 W51* probably null Het
Phip G A 9: 82,959,713 R48* probably null Het
Piezo2 T C 18: 63,084,840 T1075A probably damaging Het
Ppat G T 5: 76,928,501 probably benign Het
Ppp2r2b T A 18: 42,898,746 E23D probably null Het
Prickle1 T C 15: 93,508,636 I169V possibly damaging Het
Rab37 T A 11: 115,158,564 D95E possibly damaging Het
Sash1 A G 10: 8,751,470 V50A probably benign Het
Siae C A 9: 37,633,713 Q335K possibly damaging Het
Snx14 A T 9: 88,410,623 I217K probably damaging Het
Son A G 16: 91,658,411 T1349A possibly damaging Het
Sptb A G 12: 76,612,697 L1143S probably damaging Het
Trim80 T C 11: 115,445,113 probably null Het
Trpm3 T C 19: 22,987,292 S1374P probably benign Het
Vldlr C A 19: 27,238,402 D266E possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zbtb10 A T 3: 9,265,160 Q526L probably damaging Het
Zfr2 T C 10: 81,242,184 probably benign Het
Zswim8 G A 14: 20,713,909 R449H possibly damaging Het
Zzef1 T C 11: 72,889,035 V1878A probably damaging Het
Other mutations in Fam193b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Fam193b APN 13 55543453 missense probably damaging 1.00
IGL01761:Fam193b APN 13 55549257 missense probably benign 0.04
IGL01916:Fam193b APN 13 55550218 splice site probably benign
IGL03022:Fam193b APN 13 55543662 missense probably damaging 1.00
R0081:Fam193b UTSW 13 55554211 unclassified probably benign
R1170:Fam193b UTSW 13 55541705 missense probably damaging 1.00
R1497:Fam193b UTSW 13 55554434 missense probably damaging 0.99
R2069:Fam193b UTSW 13 55542998 missense probably damaging 1.00
R2517:Fam193b UTSW 13 55542816 missense probably damaging 1.00
R4720:Fam193b UTSW 13 55543437 missense probably benign 0.17
R4782:Fam193b UTSW 13 55543471 missense probably damaging 1.00
R4959:Fam193b UTSW 13 55543284 missense probably damaging 1.00
R6652:Fam193b UTSW 13 55542790 missense probably damaging 0.99
R6738:Fam193b UTSW 13 55550361 missense probably benign 0.01
R6822:Fam193b UTSW 13 55541691 unclassified probably benign
R7380:Fam193b UTSW 13 55542799 missense probably benign 0.00
X0011:Fam193b UTSW 13 55542630 missense probably damaging 1.00
X0066:Fam193b UTSW 13 55550260 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGTGACATGGCTCCTTCAC -3'
(R):5'- AGAAGTCAGCCTCCTCCTTG -3'

Sequencing Primer
(F):5'- GCACTTTCCCAGGTGATCG -3'
(R):5'- TCCTCCTTGGGTGAGTGCAC -3'
Posted On2015-06-20