Mutagenetix > Incidental Mutations

Incidental Mutation 'R4301:Zswim8'

322427

Institutional Source

Beutler Lab

Gene Symbol

Zswim8

Ensembl Gene

ENSMUSG00000021819

Gene Name

zinc finger SWIM-type containing 8

Synonyms

2310021P13Rik, 4832404P21Rik

MMRRC Submission

041088-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.956) question?

Stock #

R4301 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20707552-20723619 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 20713909 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 449 (R449H)

Ref Sequence

ENSEMBL: ENSMUSP00000153285 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022358] [ENSMUST00000223840] [ENSMUST00000224129] [ENSMUST00000224751]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022358
AA Change: R449H

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000022358
Gene: ENSMUSG00000021819
AA Change: R449H

Domain	Start	End	E-Value	Type
low complexity region	50	66	N/A	INTRINSIC
low complexity region	89	102	N/A	INTRINSIC
low complexity region	390	405	N/A	INTRINSIC
low complexity region	578	612	N/A	INTRINSIC
low complexity region	736	751	N/A	INTRINSIC
low complexity region	1000	1015	N/A	INTRINSIC
low complexity region	1120	1135	N/A	INTRINSIC
low complexity region	1176	1211	N/A	INTRINSIC
low complexity region	1259	1270	N/A	INTRINSIC
low complexity region	1343	1355	N/A	INTRINSIC
low complexity region	1470	1487	N/A	INTRINSIC
low complexity region	1491	1511	N/A	INTRINSIC
low complexity region	1527	1542	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223561

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223782

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223840
AA Change: R449H

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

probably benign
Transcript: ENSMUST00000224129

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224165

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224485

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224751
AA Change: R449H

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225010

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225332

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225715

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225743

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (43/43)

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3bp	T	A	16: 56,556,903	V95D	probably damaging	Het
Adamtsl2	A	G	2: 27,087,283	D252G	probably null	Het
Adgra3	T	C	5: 49,961,078	R1043G	possibly damaging	Het
Atxn7l1	A	G	12: 33,367,238	D562G	probably damaging	Het
Ccdc70	T	C	8: 21,973,212	V6A	possibly damaging	Het
Cdc25a	T	C	9: 109,889,742	V337A	probably benign	Het
Chil4	G	A	3: 106,203,727	P284S	possibly damaging	Het
Crb1	A	G	1: 139,248,830	S472P	probably benign	Het
Fam193b	G	A	13: 55,542,604	R740*	probably null	Het
Fer	G	T	17: 64,078,910	L292F	probably damaging	Het
Gmppa	G	A	1: 75,442,496	R349H	possibly damaging	Het
Hspa1a	T	C	17: 34,970,506	I474V	probably benign	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906		probably benign	Het
Lrrc30	A	G	17: 67,632,568	S6P	probably damaging	Het
Lzts3	A	G	2: 130,636,438	S133P	probably damaging	Het
Mkl2	T	C	16: 13,398,305	Y294H	probably damaging	Het
Mtmr12	T	A	15: 12,236,020	F122I	possibly damaging	Het
Mypn	A	G	10: 63,118,484	Y124H	probably damaging	Het
Nfat5	T	C	8: 107,355,695		probably benign	Het
Npr2	T	C	4: 43,641,332		probably null	Het
Olfr1441	T	C	19: 12,422,717	L136P	probably damaging	Het
Pgm1	G	A	5: 64,103,797	W51*	probably null	Het
Phip	G	A	9: 82,959,713	R48*	probably null	Het
Piezo2	T	C	18: 63,084,840	T1075A	probably damaging	Het
Ppat	G	T	5: 76,928,501		probably benign	Het
Ppp2r2b	T	A	18: 42,898,746	E23D	probably null	Het
Prickle1	T	C	15: 93,508,636	I169V	possibly damaging	Het
Rab37	T	A	11: 115,158,564	D95E	possibly damaging	Het
Sash1	A	G	10: 8,751,470	V50A	probably benign	Het
Siae	C	A	9: 37,633,713	Q335K	possibly damaging	Het
Snx14	A	T	9: 88,410,623	I217K	probably damaging	Het
Son	A	G	16: 91,658,411	T1349A	possibly damaging	Het
Sptb	A	G	12: 76,612,697	L1143S	probably damaging	Het
Trim80	T	C	11: 115,445,113		probably null	Het
Trpm3	T	C	19: 22,987,292	S1374P	probably benign	Het
Vldlr	C	A	19: 27,238,402	D266E	possibly damaging	Het
Vmn2r79	A	G	7: 87,001,891	H166R	possibly damaging	Het
Zbtb10	A	T	3: 9,265,160	Q526L	probably damaging	Het
Zfr2	T	C	10: 81,242,184		probably benign	Het
Zzef1	T	C	11: 72,889,035	V1878A	probably damaging	Het

Other mutations in Zswim8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00418:Zswim8	APN	14	20718475	missense	probably damaging	0.99
IGL00470:Zswim8	APN	14	20723181	missense	probably damaging	1.00
IGL00675:Zswim8	APN	14	20716901	unclassified	probably benign
IGL00896:Zswim8	APN	14	20716001	missense	probably damaging	1.00
IGL01343:Zswim8	APN	14	20713341	missense	probably damaging	1.00
IGL01736:Zswim8	APN	14	20714712	missense	probably benign	0.11
IGL01961:Zswim8	APN	14	20712334	missense	possibly damaging	0.76
IGL02331:Zswim8	APN	14	20723257	missense	probably damaging	1.00
IGL02485:Zswim8	APN	14	20711887	missense	probably damaging	0.98
IGL02662:Zswim8	APN	14	20713074	missense	probably benign	0.14
IGL03001:Zswim8	APN	14	20714391	missense	probably damaging	1.00
pool	UTSW	14	20714573	splice site	probably null
R0123:Zswim8	UTSW	14	20716490	splice site	probably benign
R0362:Zswim8	UTSW	14	20721945	missense	possibly damaging	0.58
R0402:Zswim8	UTSW	14	20710766	missense	probably damaging	1.00
R0458:Zswim8	UTSW	14	20718897	missense	probably damaging	1.00
R1087:Zswim8	UTSW	14	20717865	splice site	probably null
R1158:Zswim8	UTSW	14	20721668	splice site	probably benign
R1171:Zswim8	UTSW	14	20713113	missense	possibly damaging	0.94
R1389:Zswim8	UTSW	14	20710748	missense	probably damaging	1.00
R1773:Zswim8	UTSW	14	20711530	missense	probably damaging	0.96
R1780:Zswim8	UTSW	14	20716327	missense	probably damaging	0.99
R1850:Zswim8	UTSW	14	20710747	nonsense	probably null
R2421:Zswim8	UTSW	14	20719457	missense	probably damaging	1.00
R3826:Zswim8	UTSW	14	20711089	nonsense	probably null
R3965:Zswim8	UTSW	14	20713073	missense	probably benign
R4499:Zswim8	UTSW	14	20714297	missense	probably benign	0.05
R4633:Zswim8	UTSW	14	20718823	missense	probably damaging	1.00
R4675:Zswim8	UTSW	14	20714613	missense	probably benign
R4958:Zswim8	UTSW	14	20713465	missense	probably damaging	1.00
R5255:Zswim8	UTSW	14	20721651	missense	probably damaging	1.00
R5288:Zswim8	UTSW	14	20718871	missense	possibly damaging	0.92
R5341:Zswim8	UTSW	14	20716054	missense	probably damaging	1.00
R5495:Zswim8	UTSW	14	20722286	missense	probably damaging	0.97
R5652:Zswim8	UTSW	14	20713427	missense	possibly damaging	0.62
R6273:Zswim8	UTSW	14	20713453	missense	probably benign	0.06
R6281:Zswim8	UTSW	14	20714640	missense	probably benign	0.02
R6364:Zswim8	UTSW	14	20713011	missense	probably damaging	1.00
R6426:Zswim8	UTSW	14	20718526	missense	probably damaging	0.99
R6576:Zswim8	UTSW	14	20721874	missense	probably benign	0.41
R6798:Zswim8	UTSW	14	20715992	missense	probably damaging	1.00
R7059:Zswim8	UTSW	14	20714573	splice site	probably null
R7243:Zswim8	UTSW	14	20714368	missense	probably damaging	1.00
R7250:Zswim8	UTSW	14	20719968	missense	probably damaging	1.00
R7311:Zswim8	UTSW	14	20721484	missense	probably damaging	1.00
R7567:Zswim8	UTSW	14	20719933	missense	probably damaging	1.00
R7635:Zswim8	UTSW	14	20716300	missense	probably damaging	0.99
R7771:Zswim8	UTSW	14	20712980	missense	probably damaging	1.00
R7874:Zswim8	UTSW	14	20723149	missense	probably damaging	0.98
R7994:Zswim8	UTSW	14	20708004	missense	possibly damaging	0.95
R8466:Zswim8	UTSW	14	20710676	missense	possibly damaging	0.93
X0026:Zswim8	UTSW	14	20710632	splice site	probably null
X0028:Zswim8	UTSW	14	20714657	missense	probably benign	0.19
X0058:Zswim8	UTSW	14	20712990	missense	probably damaging	0.99
Z1177:Zswim8	UTSW	14	20713044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACTGTCTTATAGTGCTGGCTC -3'
(R):5'- TGGCTCAGTAGGAAGAGGTC -3'

Sequencing Primer
(F):5'- CTGTCTTATAGTGCTGGCTCAAAAAG -3'
(R):5'- AGATCTAGAGGCTCCTGGC -3'

Posted On

2015-06-20