Incidental Mutation 'R4301:Prickle1'
Institutional Source Beutler Lab
Gene Symbol Prickle1
Ensembl Gene ENSMUSG00000036158
Gene Nameprickle planar cell polarity protein 1
Synonyms1110058P22Rik, b2b019Clo, mpk1
MMRRC Submission 041088-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4301 (G1)
Quality Score225
Status Validated
Chromosomal Location93499114-93595891 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93508636 bp
Amino Acid Change Isoleucine to Valine at position 169 (I169V)
Ref Sequence ENSEMBL: ENSMUSP00000104878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048982] [ENSMUST00000109255]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048982
AA Change: I169V

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000049204
Gene: ENSMUSG00000036158
AA Change: I169V

Pfam:PET 16 116 2.2e-46 PFAM
LIM 125 182 1.73e-9 SMART
LIM 190 242 1.13e-13 SMART
LIM 250 305 2.37e-7 SMART
low complexity region 314 343 N/A INTRINSIC
low complexity region 667 684 N/A INTRINSIC
low complexity region 758 776 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109255
AA Change: I169V

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104878
Gene: ENSMUSG00000036158
AA Change: I169V

Pfam:PET 13 118 3.7e-46 PFAM
LIM 125 182 1.73e-9 SMART
LIM 190 242 1.13e-13 SMART
LIM 250 305 2.37e-7 SMART
low complexity region 314 343 N/A INTRINSIC
low complexity region 667 684 N/A INTRINSIC
low complexity region 758 776 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
Meta Mutation Damage Score 0.2024 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear receptor that may be a negative regulator of the Wnt/beta-catenin signaling pathway. The encoded protein localizes to the nuclear membrane and has been implicated in the nuclear trafficking of the transcription repressors REST/NRSF and REST4. Mutations in this gene have been linked to progressive myoclonus epilepsy. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 3. [provided by RefSeq, Sep 2009]
PHENOTYPE: Heterozygous null or point mutations result in decreased seizure threshold. Homozygous null mice display early embryonic lethality associated with altered epiblast apical-basal polarity, failed anterior migration of the distal visceral endoderm, and lackof mesoderm and primitive streak formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T A 16: 56,556,903 V95D probably damaging Het
Adamtsl2 A G 2: 27,087,283 D252G probably null Het
Adgra3 T C 5: 49,961,078 R1043G possibly damaging Het
Atxn7l1 A G 12: 33,367,238 D562G probably damaging Het
Ccdc70 T C 8: 21,973,212 V6A possibly damaging Het
Cdc25a T C 9: 109,889,742 V337A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Crb1 A G 1: 139,248,830 S472P probably benign Het
Fam193b G A 13: 55,542,604 R740* probably null Het
Fer G T 17: 64,078,910 L292F probably damaging Het
Gmppa G A 1: 75,442,496 R349H possibly damaging Het
Hspa1a T C 17: 34,970,506 I474V probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc30 A G 17: 67,632,568 S6P probably damaging Het
Lzts3 A G 2: 130,636,438 S133P probably damaging Het
Mkl2 T C 16: 13,398,305 Y294H probably damaging Het
Mtmr12 T A 15: 12,236,020 F122I possibly damaging Het
Mypn A G 10: 63,118,484 Y124H probably damaging Het
Nfat5 T C 8: 107,355,695 probably benign Het
Npr2 T C 4: 43,641,332 probably null Het
Olfr1441 T C 19: 12,422,717 L136P probably damaging Het
Pgm1 G A 5: 64,103,797 W51* probably null Het
Phip G A 9: 82,959,713 R48* probably null Het
Piezo2 T C 18: 63,084,840 T1075A probably damaging Het
Ppat G T 5: 76,928,501 probably benign Het
Ppp2r2b T A 18: 42,898,746 E23D probably null Het
Rab37 T A 11: 115,158,564 D95E possibly damaging Het
Sash1 A G 10: 8,751,470 V50A probably benign Het
Siae C A 9: 37,633,713 Q335K possibly damaging Het
Snx14 A T 9: 88,410,623 I217K probably damaging Het
Son A G 16: 91,658,411 T1349A possibly damaging Het
Sptb A G 12: 76,612,697 L1143S probably damaging Het
Trim80 T C 11: 115,445,113 probably null Het
Trpm3 T C 19: 22,987,292 S1374P probably benign Het
Vldlr C A 19: 27,238,402 D266E possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zbtb10 A T 3: 9,265,160 Q526L probably damaging Het
Zfr2 T C 10: 81,242,184 probably benign Het
Zswim8 G A 14: 20,713,909 R449H possibly damaging Het
Zzef1 T C 11: 72,889,035 V1878A probably damaging Het
Other mutations in Prickle1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Prickle1 APN 15 93500781 missense probably benign 0.29
IGL01641:Prickle1 APN 15 93500572 missense probably benign 0.05
IGL01917:Prickle1 APN 15 93503527 missense probably damaging 0.99
IGL02124:Prickle1 APN 15 93503146 missense probably damaging 1.00
IGL02754:Prickle1 APN 15 93501153 missense possibly damaging 0.94
P0028:Prickle1 UTSW 15 93500902 missense probably damaging 1.00
R0134:Prickle1 UTSW 15 93510777 missense possibly damaging 0.63
R0189:Prickle1 UTSW 15 93503019 nonsense probably null
R0225:Prickle1 UTSW 15 93510777 missense possibly damaging 0.63
R0556:Prickle1 UTSW 15 93500781 missense probably benign 0.29
R1144:Prickle1 UTSW 15 93512461 missense probably damaging 0.99
R1440:Prickle1 UTSW 15 93505074 missense possibly damaging 0.85
R1458:Prickle1 UTSW 15 93500638 missense probably damaging 1.00
R2420:Prickle1 UTSW 15 93503637 missense probably damaging 1.00
R2656:Prickle1 UTSW 15 93503370 missense probably benign 0.32
R2864:Prickle1 UTSW 15 93509278 missense probably damaging 0.99
R4912:Prickle1 UTSW 15 93500548 missense probably benign 0.00
R5085:Prickle1 UTSW 15 93500902 missense probably damaging 1.00
R5773:Prickle1 UTSW 15 93508597 missense probably damaging 1.00
R5836:Prickle1 UTSW 15 93503017 nonsense probably null
R5902:Prickle1 UTSW 15 93510672 missense probably null 0.82
R7022:Prickle1 UTSW 15 93500871 missense possibly damaging 0.82
R7474:Prickle1 UTSW 15 93508671 missense possibly damaging 0.88
R7851:Prickle1 UTSW 15 93500559 missense possibly damaging 0.49
X0066:Prickle1 UTSW 15 93503194 missense probably benign 0.00
X0067:Prickle1 UTSW 15 93508681 missense probably benign 0.21
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-06-20