Incidental Mutation 'R4301:Mkl2'
ID322429
Institutional Source Beutler Lab
Gene Symbol Mkl2
Ensembl Gene ENSMUSG00000009569
Gene NameMKL/myocardin-like 2
SynonymsGt4-1, MRTF-B, Mrtfb
MMRRC Submission 041088-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4301 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location13256481-13417529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13398305 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 294 (Y294H)
Ref Sequence ENSEMBL: ENSMUSP00000122815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009713] [ENSMUST00000149359]
Predicted Effect probably damaging
Transcript: ENSMUST00000009713
AA Change: Y305H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000009713
Gene: ENSMUSG00000009569
AA Change: Y305H

DomainStartEndE-ValueType
RPEL 51 76 9.67e-5 SMART
RPEL 95 120 2.22e-4 SMART
RPEL 139 164 1.56e-8 SMART
low complexity region 217 230 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 329 352 N/A INTRINSIC
low complexity region 369 381 N/A INTRINSIC
SAP 394 428 1.29e-8 SMART
low complexity region 495 510 N/A INTRINSIC
coiled coil region 552 601 N/A INTRINSIC
low complexity region 603 617 N/A INTRINSIC
low complexity region 699 722 N/A INTRINSIC
low complexity region 749 775 N/A INTRINSIC
low complexity region 842 854 N/A INTRINSIC
low complexity region 1039 1050 N/A INTRINSIC
low complexity region 1057 1074 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140892
Predicted Effect probably damaging
Transcript: ENSMUST00000149359
AA Change: Y294H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122815
Gene: ENSMUSG00000009569
AA Change: Y294H

DomainStartEndE-ValueType
RPEL 40 65 4.51e-5 SMART
RPEL 84 109 2.22e-4 SMART
RPEL 128 153 1.56e-8 SMART
low complexity region 206 219 N/A INTRINSIC
low complexity region 280 293 N/A INTRINSIC
low complexity region 318 341 N/A INTRINSIC
low complexity region 358 370 N/A INTRINSIC
SAP 383 417 1.29e-8 SMART
low complexity region 484 499 N/A INTRINSIC
coiled coil region 541 590 N/A INTRINSIC
low complexity region 592 606 N/A INTRINSIC
low complexity region 688 711 N/A INTRINSIC
low complexity region 738 764 N/A INTRINSIC
low complexity region 831 843 N/A INTRINSIC
low complexity region 1028 1039 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210378
Meta Mutation Damage Score 0.5375 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
MGI Phenotype PHENOTYPE: Mice homozygous for knock-out alleles exhibit prenatal lethality with widespread hemorrhaging, cardiovascular defects, and craniofacial anomalies. Mice homozygous for a gene trap allele exhibit fetal lethality due to cardiac outflow tractdefects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T A 16: 56,556,903 V95D probably damaging Het
Adamtsl2 A G 2: 27,087,283 D252G probably null Het
Adgra3 T C 5: 49,961,078 R1043G possibly damaging Het
Atxn7l1 A G 12: 33,367,238 D562G probably damaging Het
Ccdc70 T C 8: 21,973,212 V6A possibly damaging Het
Cdc25a T C 9: 109,889,742 V337A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Crb1 A G 1: 139,248,830 S472P probably benign Het
Fam193b G A 13: 55,542,604 R740* probably null Het
Fer G T 17: 64,078,910 L292F probably damaging Het
Gmppa G A 1: 75,442,496 R349H possibly damaging Het
Hspa1a T C 17: 34,970,506 I474V probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc30 A G 17: 67,632,568 S6P probably damaging Het
Lzts3 A G 2: 130,636,438 S133P probably damaging Het
Mtmr12 T A 15: 12,236,020 F122I possibly damaging Het
Mypn A G 10: 63,118,484 Y124H probably damaging Het
Nfat5 T C 8: 107,355,695 probably benign Het
Npr2 T C 4: 43,641,332 probably null Het
Olfr1441 T C 19: 12,422,717 L136P probably damaging Het
Pgm1 G A 5: 64,103,797 W51* probably null Het
Phip G A 9: 82,959,713 R48* probably null Het
Piezo2 T C 18: 63,084,840 T1075A probably damaging Het
Ppat G T 5: 76,928,501 probably benign Het
Ppp2r2b T A 18: 42,898,746 E23D probably null Het
Prickle1 T C 15: 93,508,636 I169V possibly damaging Het
Rab37 T A 11: 115,158,564 D95E possibly damaging Het
Sash1 A G 10: 8,751,470 V50A probably benign Het
Siae C A 9: 37,633,713 Q335K possibly damaging Het
Snx14 A T 9: 88,410,623 I217K probably damaging Het
Son A G 16: 91,658,411 T1349A possibly damaging Het
Sptb A G 12: 76,612,697 L1143S probably damaging Het
Trim80 T C 11: 115,445,113 probably null Het
Trpm3 T C 19: 22,987,292 S1374P probably benign Het
Vldlr C A 19: 27,238,402 D266E possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zbtb10 A T 3: 9,265,160 Q526L probably damaging Het
Zfr2 T C 10: 81,242,184 probably benign Het
Zswim8 G A 14: 20,713,909 R449H possibly damaging Het
Zzef1 T C 11: 72,889,035 V1878A probably damaging Het
Other mutations in Mkl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Mkl2 APN 16 13403222 missense probably benign 0.28
IGL00546:Mkl2 APN 16 13403225 missense possibly damaging 0.71
IGL01325:Mkl2 APN 16 13401224 missense probably damaging 1.00
IGL02125:Mkl2 APN 16 13400183 splice site probably null
IGL02803:Mkl2 APN 16 13403156 missense possibly damaging 0.94
IGL03143:Mkl2 APN 16 13400812 missense possibly damaging 0.46
IGL03180:Mkl2 APN 16 13398332 missense probably damaging 1.00
R0281:Mkl2 UTSW 16 13412163 missense probably damaging 0.99
R0505:Mkl2 UTSW 16 13412526 missense possibly damaging 0.80
R0540:Mkl2 UTSW 16 13381601 missense probably damaging 1.00
R0607:Mkl2 UTSW 16 13381601 missense probably damaging 1.00
R1073:Mkl2 UTSW 16 13412318 missense possibly damaging 0.89
R1423:Mkl2 UTSW 16 13412241 missense possibly damaging 0.96
R1432:Mkl2 UTSW 16 13401002 missense probably benign 0.01
R1459:Mkl2 UTSW 16 13401569 missense possibly damaging 0.93
R1693:Mkl2 UTSW 16 13398470 missense possibly damaging 0.67
R1693:Mkl2 UTSW 16 13398471 missense probably damaging 0.99
R2006:Mkl2 UTSW 16 13381576 nonsense probably null
R2076:Mkl2 UTSW 16 13401382 missense probably benign 0.01
R2125:Mkl2 UTSW 16 13400804 missense possibly damaging 0.94
R2145:Mkl2 UTSW 16 13412586 missense probably damaging 0.98
R3722:Mkl2 UTSW 16 13385693 missense probably damaging 1.00
R3883:Mkl2 UTSW 16 13401458 missense probably damaging 0.99
R4088:Mkl2 UTSW 16 13384200 missense probably damaging 0.98
R4204:Mkl2 UTSW 16 13403255 missense possibly damaging 0.88
R4622:Mkl2 UTSW 16 13332706 missense probably damaging 1.00
R4633:Mkl2 UTSW 16 13379873 missense possibly damaging 0.95
R4765:Mkl2 UTSW 16 13412594 missense probably damaging 1.00
R5201:Mkl2 UTSW 16 13401592 missense probably benign 0.00
R5403:Mkl2 UTSW 16 13401013 missense probably damaging 0.97
R5725:Mkl2 UTSW 16 13384310 nonsense probably null
R6511:Mkl2 UTSW 16 13379850 missense probably damaging 1.00
R7207:Mkl2 UTSW 16 13326436 missense probably benign
R7269:Mkl2 UTSW 16 13401034 missense possibly damaging 0.48
R7311:Mkl2 UTSW 16 13405854 nonsense probably null
R7460:Mkl2 UTSW 16 13400976 missense probably benign 0.00
Z1177:Mkl2 UTSW 16 13385606 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGAACAGACATTTCCTACACTG -3'
(R):5'- ACAGCTTACTTGATGGGTGC -3'

Sequencing Primer
(F):5'- AAAGTTCCTTTGCACTTTCAACACTG -3'
(R):5'- AGCTTACTTGATGGGTGCAGGTAG -3'
Posted On2015-06-20