Incidental Mutation 'R4301:Abi3bp'
Institutional Source Beutler Lab
Gene Symbol Abi3bp
Ensembl Gene ENSMUSG00000035258
Gene NameABI gene family, member 3 (NESH) binding protein
SynonymsD930038M13Rik, eratin, TARSH, 5033411B22Rik
MMRRC Submission 041088-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R4301 (G1)
Quality Score225
Status Validated
Chromosomal Location56477878-56690135 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56556903 bp
Amino Acid Change Valine to Aspartic acid at position 95 (V95D)
Ref Sequence ENSEMBL: ENSMUSP00000093712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048471] [ENSMUST00000096012] [ENSMUST00000096013] [ENSMUST00000171000] [ENSMUST00000231781] [ENSMUST00000231832] [ENSMUST00000231870]
Predicted Effect probably damaging
Transcript: ENSMUST00000048471
AA Change: V95D

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000036257
Gene: ENSMUSG00000035258
AA Change: V95D

signal peptide 1 21 N/A INTRINSIC
FN3 114 203 3.08e-2 SMART
low complexity region 433 446 N/A INTRINSIC
low complexity region 516 528 N/A INTRINSIC
low complexity region 579 591 N/A INTRINSIC
low complexity region 734 747 N/A INTRINSIC
low complexity region 751 764 N/A INTRINSIC
FN3 941 1024 6.29e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000096012
AA Change: V95D

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093711
Gene: ENSMUSG00000035258
AA Change: V95D

signal peptide 1 21 N/A INTRINSIC
FN3 114 203 3.08e-2 SMART
low complexity region 433 446 N/A INTRINSIC
low complexity region 634 647 N/A INTRINSIC
low complexity region 651 664 N/A INTRINSIC
FN3 841 924 6.29e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000096013
AA Change: V95D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000093712
Gene: ENSMUSG00000035258
AA Change: V95D

signal peptide 1 21 N/A INTRINSIC
FN3 114 203 3.08e-2 SMART
low complexity region 433 446 N/A INTRINSIC
low complexity region 670 683 N/A INTRINSIC
low complexity region 687 700 N/A INTRINSIC
FN3 877 960 6.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171000
AA Change: V95D

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000128818
Gene: ENSMUSG00000035258
AA Change: V95D

signal peptide 1 21 N/A INTRINSIC
FN3 114 203 3.08e-2 SMART
low complexity region 464 477 N/A INTRINSIC
low complexity region 481 494 N/A INTRINSIC
FN3 671 754 6.29e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231337
Predicted Effect probably damaging
Transcript: ENSMUST00000231781
AA Change: V95D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231832
AA Change: V95D

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000231870
AA Change: V95D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.1415 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl2 A G 2: 27,087,283 D252G probably null Het
Adgra3 T C 5: 49,961,078 R1043G possibly damaging Het
Atxn7l1 A G 12: 33,367,238 D562G probably damaging Het
Ccdc70 T C 8: 21,973,212 V6A possibly damaging Het
Cdc25a T C 9: 109,889,742 V337A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Crb1 A G 1: 139,248,830 S472P probably benign Het
Fam193b G A 13: 55,542,604 R740* probably null Het
Fer G T 17: 64,078,910 L292F probably damaging Het
Gmppa G A 1: 75,442,496 R349H possibly damaging Het
Hspa1a T C 17: 34,970,506 I474V probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc30 A G 17: 67,632,568 S6P probably damaging Het
Lzts3 A G 2: 130,636,438 S133P probably damaging Het
Mkl2 T C 16: 13,398,305 Y294H probably damaging Het
Mtmr12 T A 15: 12,236,020 F122I possibly damaging Het
Mypn A G 10: 63,118,484 Y124H probably damaging Het
Nfat5 T C 8: 107,355,695 probably benign Het
Npr2 T C 4: 43,641,332 probably null Het
Olfr1441 T C 19: 12,422,717 L136P probably damaging Het
Pgm1 G A 5: 64,103,797 W51* probably null Het
Phip G A 9: 82,959,713 R48* probably null Het
Piezo2 T C 18: 63,084,840 T1075A probably damaging Het
Ppat G T 5: 76,928,501 probably benign Het
Ppp2r2b T A 18: 42,898,746 E23D probably null Het
Prickle1 T C 15: 93,508,636 I169V possibly damaging Het
Rab37 T A 11: 115,158,564 D95E possibly damaging Het
Sash1 A G 10: 8,751,470 V50A probably benign Het
Siae C A 9: 37,633,713 Q335K possibly damaging Het
Snx14 A T 9: 88,410,623 I217K probably damaging Het
Son A G 16: 91,658,411 T1349A possibly damaging Het
Sptb A G 12: 76,612,697 L1143S probably damaging Het
Trim80 T C 11: 115,445,113 probably null Het
Trpm3 T C 19: 22,987,292 S1374P probably benign Het
Vldlr C A 19: 27,238,402 D266E possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zbtb10 A T 3: 9,265,160 Q526L probably damaging Het
Zfr2 T C 10: 81,242,184 probably benign Het
Zswim8 G A 14: 20,713,909 R449H possibly damaging Het
Zzef1 T C 11: 72,889,035 V1878A probably damaging Het
Other mutations in Abi3bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Abi3bp APN 16 56602805 missense probably null 0.99
IGL01580:Abi3bp APN 16 56675210 missense probably damaging 1.00
IGL01633:Abi3bp APN 16 56677800 missense probably damaging 1.00
IGL01783:Abi3bp APN 16 56532969 critical splice donor site probably null
IGL01866:Abi3bp APN 16 56671973 missense probably benign 0.19
IGL02022:Abi3bp APN 16 56592636 missense probably damaging 1.00
IGL02086:Abi3bp APN 16 56642567 splice site probably benign
IGL02122:Abi3bp APN 16 56687128 splice site probably benign
IGL02155:Abi3bp APN 16 56587964 missense probably damaging 0.99
IGL02351:Abi3bp APN 16 56654055 missense possibly damaging 0.91
IGL02358:Abi3bp APN 16 56654055 missense possibly damaging 0.91
IGL02418:Abi3bp APN 16 56604116 splice site probably benign
IGL02559:Abi3bp APN 16 56687070 nonsense probably null
IGL02617:Abi3bp APN 16 56574444 nonsense probably null
IGL02810:Abi3bp APN 16 56677775 missense probably damaging 1.00
IGL03057:Abi3bp APN 16 56668391 missense possibly damaging 0.95
IGL03174:Abi3bp APN 16 56614747 missense possibly damaging 0.64
R0389:Abi3bp UTSW 16 56671307 missense possibly damaging 0.79
R0485:Abi3bp UTSW 16 56604012 intron probably null
R0557:Abi3bp UTSW 16 56668387 missense probably damaging 0.97
R0616:Abi3bp UTSW 16 56654070 missense probably damaging 0.99
R0685:Abi3bp UTSW 16 56532953 missense possibly damaging 0.90
R0783:Abi3bp UTSW 16 56595238 critical splice acceptor site probably null
R0828:Abi3bp UTSW 16 56677830 missense probably damaging 1.00
R0841:Abi3bp UTSW 16 56668276 missense possibly damaging 0.95
R1078:Abi3bp UTSW 16 56654081 critical splice donor site probably null
R1101:Abi3bp UTSW 16 56606158 missense probably damaging 1.00
R1116:Abi3bp UTSW 16 56686429 splice site probably benign
R1145:Abi3bp UTSW 16 56668276 missense possibly damaging 0.95
R1145:Abi3bp UTSW 16 56668276 missense possibly damaging 0.95
R1317:Abi3bp UTSW 16 56668309 missense possibly damaging 0.79
R1384:Abi3bp UTSW 16 56574499 missense probably damaging 1.00
R1460:Abi3bp UTSW 16 56562417 missense probably damaging 0.99
R1730:Abi3bp UTSW 16 56668279 missense possibly damaging 0.62
R1761:Abi3bp UTSW 16 56668309 missense possibly damaging 0.79
R1830:Abi3bp UTSW 16 56587985 missense probably damaging 1.00
R1873:Abi3bp UTSW 16 56574499 missense probably damaging 1.00
R1875:Abi3bp UTSW 16 56574499 missense probably damaging 1.00
R1996:Abi3bp UTSW 16 56671357 missense possibly damaging 0.61
R2018:Abi3bp UTSW 16 56677796 missense probably damaging 1.00
R2019:Abi3bp UTSW 16 56677796 missense probably damaging 1.00
R2035:Abi3bp UTSW 16 56660218 missense probably benign 0.21
R2118:Abi3bp UTSW 16 56477864 unclassified probably benign
R2202:Abi3bp UTSW 16 56613203 missense probably benign 0.06
R2202:Abi3bp UTSW 16 56650725 nonsense probably null
R2203:Abi3bp UTSW 16 56613203 missense probably benign 0.06
R3030:Abi3bp UTSW 16 56657319 missense possibly damaging 0.79
R3952:Abi3bp UTSW 16 56604038 missense possibly damaging 0.88
R4176:Abi3bp UTSW 16 56652200 missense probably damaging 0.96
R4296:Abi3bp UTSW 16 56668310 missense probably benign 0.05
R4354:Abi3bp UTSW 16 56532951 missense probably benign 0.05
R4417:Abi3bp UTSW 16 56654035 missense probably damaging 1.00
R4716:Abi3bp UTSW 16 56650725 nonsense probably null
R4808:Abi3bp UTSW 16 56594516 missense probably damaging 0.96
R4814:Abi3bp UTSW 16 56650753 missense probably benign 0.06
R5016:Abi3bp UTSW 16 56671268 missense probably damaging 0.97
R5290:Abi3bp UTSW 16 56642475 splice site probably null
R5891:Abi3bp UTSW 16 56606133 missense probably damaging 1.00
R5897:Abi3bp UTSW 16 56604669 missense possibly damaging 0.53
R6146:Abi3bp UTSW 16 56671265 missense probably damaging 0.99
R6267:Abi3bp UTSW 16 56594497 missense probably damaging 0.97
R6905:Abi3bp UTSW 16 56574517 missense probably damaging 1.00
R6908:Abi3bp UTSW 16 56657305 missense probably benign 0.01
R6917:Abi3bp UTSW 16 56617321 intron probably null
R7071:Abi3bp UTSW 16 56629140 nonsense probably null
R7194:Abi3bp UTSW 16 56562371 missense probably damaging 0.99
R7476:Abi3bp UTSW 16 56614746 nonsense probably null
R7554:Abi3bp UTSW 16 56618212 splice site probably null
R7571:Abi3bp UTSW 16 56630982 splice site probably null
R7661:Abi3bp UTSW 16 56632900 splice site probably null
R7662:Abi3bp UTSW 16 56617323 intron probably null
R7910:Abi3bp UTSW 16 56677742 nonsense probably null
R8121:Abi3bp UTSW 16 56631878 missense unknown
RF008:Abi3bp UTSW 16 56627589 intron probably benign
RF016:Abi3bp UTSW 16 56627587 frame shift probably null
RF052:Abi3bp UTSW 16 56627585 intron probably benign
RF061:Abi3bp UTSW 16 56627587 frame shift probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-06-20