Incidental Mutation 'R4301:Trpm3'
Institutional Source Beutler Lab
Gene Symbol Trpm3
Ensembl Gene ENSMUSG00000052387
Gene Nametransient receptor potential cation channel, subfamily M, member 3
SynonymsB930001P07Rik, 6330504P12Rik, MLSN2, melastatin 2, LTRPC3
MMRRC Submission 041088-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R4301 (G1)
Quality Score225
Status Validated
Chromosomal Location22139119-22989884 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22987292 bp
Amino Acid Change Serine to Proline at position 1374 (S1374P)
Ref Sequence ENSEMBL: ENSMUSP00000074328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037901] [ENSMUST00000074770] [ENSMUST00000087576] [ENSMUST00000099569]
Predicted Effect probably benign
Transcript: ENSMUST00000037901
SMART Domains Protein: ENSMUSP00000042184
Gene: ENSMUSG00000052387

Blast:ANK 485 514 1e-6 BLAST
low complexity region 619 631 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 788 800 N/A INTRINSIC
low complexity region 821 840 N/A INTRINSIC
Pfam:Ion_trans 883 1136 1.7e-19 PFAM
Pfam:TRPM_tetra 1227 1282 1.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074770
AA Change: S1374P

PolyPhen 2 Score 0.231 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000074328
Gene: ENSMUSG00000052387
AA Change: S1374P

low complexity region 16 33 N/A INTRINSIC
Blast:ANK 487 516 5e-7 BLAST
low complexity region 611 623 N/A INTRINSIC
low complexity region 666 681 N/A INTRINSIC
low complexity region 780 792 N/A INTRINSIC
low complexity region 813 832 N/A INTRINSIC
transmembrane domain 874 896 N/A INTRINSIC
Pfam:Ion_trans 908 1116 5.1e-14 PFAM
low complexity region 1378 1388 N/A INTRINSIC
low complexity region 1433 1455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087576
AA Change: S1384P

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000084857
Gene: ENSMUSG00000052387
AA Change: S1384P

low complexity region 16 33 N/A INTRINSIC
Blast:ANK 487 516 5e-7 BLAST
low complexity region 621 633 N/A INTRINSIC
low complexity region 676 691 N/A INTRINSIC
low complexity region 790 802 N/A INTRINSIC
low complexity region 823 842 N/A INTRINSIC
transmembrane domain 884 906 N/A INTRINSIC
Pfam:Ion_trans 918 1126 5.1e-14 PFAM
low complexity region 1388 1398 N/A INTRINSIC
low complexity region 1443 1465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099569
AA Change: S1384P

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000097164
Gene: ENSMUSG00000052387
AA Change: S1384P

low complexity region 16 33 N/A INTRINSIC
Blast:ANK 487 516 6e-7 BLAST
low complexity region 609 621 N/A INTRINSIC
low complexity region 664 679 N/A INTRINSIC
low complexity region 778 790 N/A INTRINSIC
low complexity region 811 830 N/A INTRINSIC
Pfam:Ion_trans 873 1138 3.2e-19 PFAM
Pfam:TRPM_tetra 1229 1284 4.4e-26 PFAM
low complexity region 1388 1398 N/A INTRINSIC
low complexity region 1443 1465 N/A INTRINSIC
Meta Mutation Damage Score 0.0973 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of transient receptor potential (TRP) channels. TRP channels are cation-selective channels important for cellular calcium signaling and homeostasis. The protein encoded by this gene mediates calcium entry, and this entry is potentiated by calcium store depletion. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display impaired thermal and chemical nociception. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T A 16: 56,556,903 V95D probably damaging Het
Adamtsl2 A G 2: 27,087,283 D252G probably null Het
Adgra3 T C 5: 49,961,078 R1043G possibly damaging Het
Atxn7l1 A G 12: 33,367,238 D562G probably damaging Het
Ccdc70 T C 8: 21,973,212 V6A possibly damaging Het
Cdc25a T C 9: 109,889,742 V337A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Crb1 A G 1: 139,248,830 S472P probably benign Het
Fam193b G A 13: 55,542,604 R740* probably null Het
Fer G T 17: 64,078,910 L292F probably damaging Het
Gmppa G A 1: 75,442,496 R349H possibly damaging Het
Hspa1a T C 17: 34,970,506 I474V probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc30 A G 17: 67,632,568 S6P probably damaging Het
Lzts3 A G 2: 130,636,438 S133P probably damaging Het
Mkl2 T C 16: 13,398,305 Y294H probably damaging Het
Mtmr12 T A 15: 12,236,020 F122I possibly damaging Het
Mypn A G 10: 63,118,484 Y124H probably damaging Het
Nfat5 T C 8: 107,355,695 probably benign Het
Npr2 T C 4: 43,641,332 probably null Het
Olfr1441 T C 19: 12,422,717 L136P probably damaging Het
Pgm1 G A 5: 64,103,797 W51* probably null Het
Phip G A 9: 82,959,713 R48* probably null Het
Piezo2 T C 18: 63,084,840 T1075A probably damaging Het
Ppat G T 5: 76,928,501 probably benign Het
Ppp2r2b T A 18: 42,898,746 E23D probably null Het
Prickle1 T C 15: 93,508,636 I169V possibly damaging Het
Rab37 T A 11: 115,158,564 D95E possibly damaging Het
Sash1 A G 10: 8,751,470 V50A probably benign Het
Siae C A 9: 37,633,713 Q335K possibly damaging Het
Snx14 A T 9: 88,410,623 I217K probably damaging Het
Son A G 16: 91,658,411 T1349A possibly damaging Het
Sptb A G 12: 76,612,697 L1143S probably damaging Het
Trim80 T C 11: 115,445,113 probably null Het
Vldlr C A 19: 27,238,402 D266E possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zbtb10 A T 3: 9,265,160 Q526L probably damaging Het
Zfr2 T C 10: 81,242,184 probably benign Het
Zswim8 G A 14: 20,713,909 R449H possibly damaging Het
Zzef1 T C 11: 72,889,035 V1878A probably damaging Het
Other mutations in Trpm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Trpm3 APN 19 22987659 missense probably benign 0.00
IGL00773:Trpm3 APN 19 22900159 missense possibly damaging 0.92
IGL00852:Trpm3 APN 19 22987071 missense possibly damaging 0.93
IGL01597:Trpm3 APN 19 22715246 missense probably damaging 1.00
IGL01607:Trpm3 APN 19 22987127 missense probably benign 0.01
IGL01818:Trpm3 APN 19 22914474 missense probably damaging 1.00
IGL01890:Trpm3 APN 19 22711719 missense probably damaging 0.98
IGL02016:Trpm3 APN 19 22902069 nonsense probably null
IGL02324:Trpm3 APN 19 22698779 missense probably benign 0.25
IGL02947:Trpm3 APN 19 22901119 missense probably damaging 0.99
IGL03037:Trpm3 APN 19 22889412 missense possibly damaging 0.85
IGL03128:Trpm3 APN 19 22914465 missense probably damaging 1.00
IGL03335:Trpm3 APN 19 22926071 critical splice donor site probably null
IGL03354:Trpm3 APN 19 22856718 missense probably damaging 1.00
bit UTSW 19 22987869 missense probably benign 0.00
P0041:Trpm3 UTSW 19 22897686 missense probably benign 0.01
R0001:Trpm3 UTSW 19 22715331 missense possibly damaging 0.70
R0007:Trpm3 UTSW 19 22987529 missense probably benign 0.00
R0007:Trpm3 UTSW 19 22987529 missense probably benign 0.00
R0009:Trpm3 UTSW 19 22914446 missense probably damaging 1.00
R0009:Trpm3 UTSW 19 22914446 missense probably damaging 1.00
R0142:Trpm3 UTSW 19 22987916 missense probably damaging 0.98
R0194:Trpm3 UTSW 19 22715356 splice site probably null
R0268:Trpm3 UTSW 19 22897521 critical splice donor site probably null
R0299:Trpm3 UTSW 19 22986873 missense possibly damaging 0.62
R0449:Trpm3 UTSW 19 22988054 missense probably benign
R0481:Trpm3 UTSW 19 22901071 missense possibly damaging 0.51
R0496:Trpm3 UTSW 19 22698778 missense probably benign 0.00
R0499:Trpm3 UTSW 19 22986873 missense possibly damaging 0.62
R0550:Trpm3 UTSW 19 22987812 missense probably damaging 0.97
R0729:Trpm3 UTSW 19 22987789 missense probably benign
R0883:Trpm3 UTSW 19 22978654 missense probably damaging 1.00
R0926:Trpm3 UTSW 19 22988043 missense probably benign 0.02
R1185:Trpm3 UTSW 19 22914417 splice site probably benign
R1185:Trpm3 UTSW 19 22914417 splice site probably benign
R1513:Trpm3 UTSW 19 22986872 missense possibly damaging 0.96
R1521:Trpm3 UTSW 19 22901221 missense probably damaging 1.00
R1522:Trpm3 UTSW 19 22978334 missense probably benign 0.39
R1569:Trpm3 UTSW 19 22889445 critical splice donor site probably null
R1598:Trpm3 UTSW 19 22733024 missense possibly damaging 0.47
R1600:Trpm3 UTSW 19 22139155 missense probably benign 0.00
R1616:Trpm3 UTSW 19 22982712 missense probably damaging 1.00
R1619:Trpm3 UTSW 19 22711907 missense probably damaging 0.99
R1923:Trpm3 UTSW 19 22885412 missense probably damaging 1.00
R1985:Trpm3 UTSW 19 22926082 missense possibly damaging 0.56
R2002:Trpm3 UTSW 19 22982583 missense probably damaging 1.00
R2249:Trpm3 UTSW 19 22733034 missense probably benign 0.15
R3719:Trpm3 UTSW 19 22986990 missense possibly damaging 0.95
R3766:Trpm3 UTSW 19 22448377 missense probably benign
R3774:Trpm3 UTSW 19 22978602 missense possibly damaging 0.66
R3774:Trpm3 UTSW 19 22987975 missense probably benign 0.03
R3776:Trpm3 UTSW 19 22978602 missense possibly damaging 0.66
R3820:Trpm3 UTSW 19 22987449 missense probably benign 0.00
R3899:Trpm3 UTSW 19 22901160 missense possibly damaging 0.90
R4204:Trpm3 UTSW 19 22987564 missense probably benign 0.00
R4238:Trpm3 UTSW 19 22978638 missense probably damaging 1.00
R4344:Trpm3 UTSW 19 22897697 missense probably damaging 0.99
R4345:Trpm3 UTSW 19 22897697 missense probably damaging 0.99
R4365:Trpm3 UTSW 19 22978330 missense probably benign 0.00
R4510:Trpm3 UTSW 19 22988017 missense probably benign 0.00
R4511:Trpm3 UTSW 19 22988017 missense probably benign 0.00
R4565:Trpm3 UTSW 19 22987869 missense probably benign 0.00
R4573:Trpm3 UTSW 19 22902142 missense probably damaging 1.00
R4606:Trpm3 UTSW 19 22978624 missense probably benign 0.26
R4677:Trpm3 UTSW 19 22987388 missense possibly damaging 0.95
R4684:Trpm3 UTSW 19 22987781 missense probably benign
R4713:Trpm3 UTSW 19 22889435 missense possibly damaging 0.83
R4745:Trpm3 UTSW 19 22715295 missense possibly damaging 0.67
R5015:Trpm3 UTSW 19 22711712 missense probably damaging 1.00
R5030:Trpm3 UTSW 19 22698766 missense probably benign 0.01
R5074:Trpm3 UTSW 19 22885349 missense possibly damaging 0.65
R5089:Trpm3 UTSW 19 22766756 missense probably damaging 0.97
R5100:Trpm3 UTSW 19 22918766 missense probably damaging 0.99
R5108:Trpm3 UTSW 19 22904714 missense probably benign 0.06
R5204:Trpm3 UTSW 19 22448341 nonsense probably null
R5213:Trpm3 UTSW 19 22697454 nonsense probably null
R5358:Trpm3 UTSW 19 22925968 missense probably damaging 1.00
R5374:Trpm3 UTSW 19 22926184 nonsense probably null
R5382:Trpm3 UTSW 19 22885341 splice site probably null
R5509:Trpm3 UTSW 19 22987258 missense probably damaging 0.99
R5558:Trpm3 UTSW 19 22978573 missense probably damaging 1.00
R6154:Trpm3 UTSW 19 22987814 missense probably damaging 1.00
R6250:Trpm3 UTSW 19 22910054 missense probably benign 0.01
R6433:Trpm3 UTSW 19 22901305 missense probably damaging 1.00
R6542:Trpm3 UTSW 19 22926113 missense probably benign 0.04
R6630:Trpm3 UTSW 19 22987983 missense probably benign 0.00
R6640:Trpm3 UTSW 19 22978582 missense probably damaging 1.00
R6725:Trpm3 UTSW 19 22926028 missense probably damaging 1.00
R7275:Trpm3 UTSW 19 22978684 missense possibly damaging 0.71
R7371:Trpm3 UTSW 19 22902193 missense probably benign 0.27
R7467:Trpm3 UTSW 19 22978334 missense possibly damaging 0.82
R7488:Trpm3 UTSW 19 22978573 missense probably damaging 1.00
R7495:Trpm3 UTSW 19 22897796 missense probably benign 0.28
R7600:Trpm3 UTSW 19 22926094 missense possibly damaging 0.68
R7710:Trpm3 UTSW 19 22918790 missense probably damaging 0.97
R7877:Trpm3 UTSW 19 22904784 missense probably benign 0.25
R8184:Trpm3 UTSW 19 22918696 missense possibly damaging 0.46
R8234:Trpm3 UTSW 19 22715276 missense possibly damaging 0.47
R8236:Trpm3 UTSW 19 22987408 missense probably benign 0.00
Z1176:Trpm3 UTSW 19 22987490 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-06-20