Mutagenetix > Incidental Mutations

Incidental Mutation 'R4301:Vldlr'

322440

Institutional Source

Beutler Lab

Gene Symbol

Vldlr

Ensembl Gene

ENSMUSG00000024924

Gene Name

very low density lipoprotein receptor

Synonyms

AA408956, AI451093, AW047288, VLDL receptor

MMRRC Submission

041088-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.331) question?

Stock #

R4301 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27216484-27254231 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 27238402 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 266 (D266E)

Ref Sequence

ENSEMBL: ENSMUSP00000127329 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025866] [ENSMUST00000047645] [ENSMUST00000164746] [ENSMUST00000165761] [ENSMUST00000167487] [ENSMUST00000172302]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025866
AA Change: D266E

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000025866
Gene: ENSMUSG00000024924
AA Change: D266E

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
EGF_like	32	68	7.38e1	SMART
LDLa	32	69	1.69e-16	SMART
LDLa	71	110	5.81e-15	SMART
LDLa	112	151	1.96e-12	SMART
LDLa	153	190	7.15e-15	SMART
LDLa	192	231	1.23e-13	SMART
LDLa	238	275	1.1e-15	SMART
LDLa	277	314	1.13e-12	SMART
LDLa	317	357	3.86e-11	SMART
EGF_CA	356	395	1e-5	SMART
EGF_CA	396	435	6.1e-10	SMART
Blast:LY	461	495	4e-15	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000047645
AA Change: D225E

PolyPhen 2 Score 0.474 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000049145
Gene: ENSMUSG00000024924
AA Change: D225E

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
EGF_like	32	68	7.38e1	SMART
LDLa	32	69	1.69e-16	SMART
LDLa	71	110	1.25e-14	SMART
LDLa	112	149	7.15e-15	SMART
LDLa	151	190	1.23e-13	SMART
LDLa	197	234	1.1e-15	SMART
LDLa	236	273	1.13e-12	SMART
LDLa	276	316	3.86e-11	SMART
EGF_CA	315	354	1e-5	SMART
EGF_CA	355	394	6.1e-10	SMART
LY	420	462	2.16e-1	SMART
LY	464	506	9.54e-12	SMART
LY	507	550	2.22e-12	SMART
LY	551	593	1.66e-11	SMART
LY	594	637	5.97e-4	SMART
EGF	664	709	2.16e-1	SMART
transmembrane domain	728	750	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164509

Predicted Effect

probably benign
Transcript: ENSMUST00000164746

SMART Domains

Protein: ENSMUSP00000128193
Gene: ENSMUSG00000024924

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
LDLa	32	69	1.69e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000165761

SMART Domains

Protein: ENSMUSP00000130382
Gene: ENSMUSG00000024924

Domain	Start	End	E-Value	Type
LDLa	1	26	1.58e0	SMART
EGF	28	64	4e-5	SMART
LY	88	130	2.16e-1	SMART
LY	132	174	9.54e-12	SMART
LY	175	218	2.22e-12	SMART
LY	219	258	3.25e-5	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167487
AA Change: D266E

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000127329
Gene: ENSMUSG00000024924
AA Change: D266E

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
EGF_like	32	68	7.38e1	SMART
LDLa	32	69	1.69e-16	SMART
LDLa	71	110	5.81e-15	SMART
LDLa	112	151	1.96e-12	SMART
LDLa	153	190	7.15e-15	SMART
LDLa	192	231	1.23e-13	SMART
LDLa	238	275	1.1e-15	SMART
LDLa	277	314	1.13e-12	SMART
LDLa	317	357	3.86e-11	SMART
EGF_CA	356	395	1e-5	SMART
EGF_CA	396	435	6.1e-10	SMART
LY	461	503	2.16e-1	SMART
LY	505	547	9.54e-12	SMART
LY	548	591	2.22e-12	SMART
LY	592	634	1.66e-11	SMART
LY	635	678	5.97e-4	SMART
EGF	705	750	2.16e-1	SMART
transmembrane domain	797	819	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172302
AA Change: D266E

PolyPhen 2 Score 0.295 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000126730
Gene: ENSMUSG00000024924
AA Change: D266E

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
EGF_like	32	68	7.38e1	SMART
LDLa	32	69	1.69e-16	SMART
LDLa	71	110	5.81e-15	SMART
LDLa	112	151	1.96e-12	SMART
LDLa	153	190	7.15e-15	SMART
LDLa	192	231	1.23e-13	SMART
LDLa	238	275	1.1e-15	SMART
LDLa	277	314	1.13e-12	SMART
LDLa	317	357	3.86e-11	SMART
EGF_CA	356	395	1e-5	SMART
EGF_CA	396	435	6.1e-10	SMART
LY	461	503	2.16e-1	SMART
LY	505	547	9.54e-12	SMART
LY	548	591	2.22e-12	SMART
LY	592	634	1.66e-11	SMART
LY	635	678	5.97e-4	SMART
EGF	705	750	2.16e-1	SMART
transmembrane domain	769	791	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. This gene encodes a lipoprotein receptor that is a member of the LDLR family and plays important roles in VLDL-triglyceride metabolism and the reelin signaling pathway. Mutations in this gene cause VLDLR-associated cerebellar hypoplasia. Alternative splicing generates multiple transcript variants encoding distinct isoforms for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygous null mutants exhibit modest reductions in body weight and adiposity. In behavioral tests, mutants display deficits in contextual fear conditioning and long term potentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3bp	T	A	16: 56,556,903	V95D	probably damaging	Het
Adamtsl2	A	G	2: 27,087,283	D252G	probably null	Het
Adgra3	T	C	5: 49,961,078	R1043G	possibly damaging	Het
Atxn7l1	A	G	12: 33,367,238	D562G	probably damaging	Het
Ccdc70	T	C	8: 21,973,212	V6A	possibly damaging	Het
Cdc25a	T	C	9: 109,889,742	V337A	probably benign	Het
Chil4	G	A	3: 106,203,727	P284S	possibly damaging	Het
Crb1	A	G	1: 139,248,830	S472P	probably benign	Het
Fam193b	G	A	13: 55,542,604	R740*	probably null	Het
Fer	G	T	17: 64,078,910	L292F	probably damaging	Het
Gmppa	G	A	1: 75,442,496	R349H	possibly damaging	Het
Hspa1a	T	C	17: 34,970,506	I474V	probably benign	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906		probably benign	Het
Lrrc30	A	G	17: 67,632,568	S6P	probably damaging	Het
Lzts3	A	G	2: 130,636,438	S133P	probably damaging	Het
Mkl2	T	C	16: 13,398,305	Y294H	probably damaging	Het
Mtmr12	T	A	15: 12,236,020	F122I	possibly damaging	Het
Mypn	A	G	10: 63,118,484	Y124H	probably damaging	Het
Nfat5	T	C	8: 107,355,695		probably benign	Het
Npr2	T	C	4: 43,641,332		probably null	Het
Olfr1441	T	C	19: 12,422,717	L136P	probably damaging	Het
Pgm1	G	A	5: 64,103,797	W51*	probably null	Het
Phip	G	A	9: 82,959,713	R48*	probably null	Het
Piezo2	T	C	18: 63,084,840	T1075A	probably damaging	Het
Ppat	G	T	5: 76,928,501		probably benign	Het
Ppp2r2b	T	A	18: 42,898,746	E23D	probably null	Het
Prickle1	T	C	15: 93,508,636	I169V	possibly damaging	Het
Rab37	T	A	11: 115,158,564	D95E	possibly damaging	Het
Sash1	A	G	10: 8,751,470	V50A	probably benign	Het
Siae	C	A	9: 37,633,713	Q335K	possibly damaging	Het
Snx14	A	T	9: 88,410,623	I217K	probably damaging	Het
Son	A	G	16: 91,658,411	T1349A	possibly damaging	Het
Sptb	A	G	12: 76,612,697	L1143S	probably damaging	Het
Trim80	T	C	11: 115,445,113		probably null	Het
Trpm3	T	C	19: 22,987,292	S1374P	probably benign	Het
Vmn2r79	A	G	7: 87,001,891	H166R	possibly damaging	Het
Zbtb10	A	T	3: 9,265,160	Q526L	probably damaging	Het
Zfr2	T	C	10: 81,242,184		probably benign	Het
Zswim8	G	A	14: 20,713,909	R449H	possibly damaging	Het
Zzef1	T	C	11: 72,889,035	V1878A	probably damaging	Het

Other mutations in Vldlr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01346:Vldlr	APN	19	27239681	missense	possibly damaging	0.93
IGL01575:Vldlr	APN	19	27246631	missense	probably benign
IGL01626:Vldlr	APN	19	27243773	missense	probably damaging	1.00
IGL02213:Vldlr	APN	19	27241326	missense	probably benign	0.09
IGL02365:Vldlr	APN	19	27245625	missense	probably damaging	1.00
IGL02488:Vldlr	APN	19	27238275	missense	probably damaging	1.00
IGL02708:Vldlr	APN	19	27238085	missense	possibly damaging	0.92
IGL02947:Vldlr	APN	19	27239720	missense	probably benign	0.03
r26	UTSW	19	27245654	missense	probably damaging	0.99
spotty	UTSW	19	27238792	missense	probably damaging	1.00
PIT4142001:Vldlr	UTSW	19	27234869	missense	probably benign	0.05
R0195:Vldlr	UTSW	19	27238386	missense	probably damaging	1.00
R0288:Vldlr	UTSW	19	27240651	splice site	probably benign
R0536:Vldlr	UTSW	19	27239964	missense	probably damaging	1.00
R0537:Vldlr	UTSW	19	27247918	missense	probably damaging	1.00
R0542:Vldlr	UTSW	19	27236255	missense	probably benign	0.01
R0594:Vldlr	UTSW	19	27234819	missense	probably damaging	1.00
R0624:Vldlr	UTSW	19	27238263	missense	possibly damaging	0.91
R0726:Vldlr	UTSW	19	27238386	missense	probably damaging	1.00
R1017:Vldlr	UTSW	19	27241333	missense	probably damaging	1.00
R1148:Vldlr	UTSW	19	27241291	missense	probably benign	0.01
R1148:Vldlr	UTSW	19	27241291	missense	probably benign	0.01
R1443:Vldlr	UTSW	19	27239721	missense	possibly damaging	0.91
R1493:Vldlr	UTSW	19	27241291	missense	probably benign	0.01
R1520:Vldlr	UTSW	19	27240543	missense	probably damaging	0.99
R1520:Vldlr	UTSW	19	27247066	missense	possibly damaging	0.96
R1657:Vldlr	UTSW	19	27245670	missense	probably benign	0.00
R1901:Vldlr	UTSW	19	27241309	missense	probably damaging	1.00
R2047:Vldlr	UTSW	19	27234838	missense	probably damaging	1.00
R2258:Vldlr	UTSW	19	27238386	missense	probably damaging	1.00
R2273:Vldlr	UTSW	19	27248015	missense	probably damaging	1.00
R2423:Vldlr	UTSW	19	27236288	missense	possibly damaging	0.49
R3196:Vldlr	UTSW	19	27243154	missense	probably damaging	0.98
R3752:Vldlr	UTSW	19	27238331	missense	probably damaging	1.00
R3801:Vldlr	UTSW	19	27217621	missense	probably damaging	0.99
R3835:Vldlr	UTSW	19	27234814	missense	probably damaging	1.00
R4027:Vldlr	UTSW	19	27238313	missense	probably benign
R4470:Vldlr	UTSW	19	27234819	missense	probably damaging	0.96
R4541:Vldlr	UTSW	19	27238792	missense	probably damaging	1.00
R4765:Vldlr	UTSW	19	27240547	missense	probably damaging	1.00
R4771:Vldlr	UTSW	19	27239890	missense	probably damaging	0.97
R4795:Vldlr	UTSW	19	27238852	splice site	probably null
R4839:Vldlr	UTSW	19	27238065	missense	probably damaging	1.00
R5074:Vldlr	UTSW	19	27238277	missense	probably damaging	1.00
R5134:Vldlr	UTSW	19	27238812	nonsense	probably null
R5281:Vldlr	UTSW	19	27244231	missense	probably benign	0.44
R5466:Vldlr	UTSW	19	27239843	critical splice acceptor site	probably null
R5514:Vldlr	UTSW	19	27244224	missense	probably damaging	0.97
R5886:Vldlr	UTSW	19	27243771	missense	probably benign	0.03
R5889:Vldlr	UTSW	19	27239664	missense	probably damaging	1.00
R6110:Vldlr	UTSW	19	27238077	missense	possibly damaging	0.92
R6343:Vldlr	UTSW	19	27245649	missense	probably damaging	0.99
R6833:Vldlr	UTSW	19	27240574	missense	probably damaging	1.00
R6838:Vldlr	UTSW	19	27247970	missense	probably damaging	1.00
R7169:Vldlr	UTSW	19	27244328	missense	probably benign
R7197:Vldlr	UTSW	19	27234841	missense	probably benign	0.36
R7304:Vldlr	UTSW	19	27238604	missense	possibly damaging	0.93
R7403:Vldlr	UTSW	19	27236274	nonsense	probably null
R7658:Vldlr	UTSW	19	27243136	missense	probably benign	0.33
R7754:Vldlr	UTSW	19	27217615	start codon destroyed	probably benign	0.01
R8105:Vldlr	UTSW	19	27238804	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGTGATGAGCTGGACTGTGC -3'
(R):5'- TCAACACAGTCTCGGATGCC -3'

Sequencing Primer
(F):5'- AGTTCCAGTGCAGCACCTC -3'
(R):5'- ACAGTCTCGGATGCCATTGC -3'

Posted On

2015-06-20