Mutagenetix > Incidental Mutations

Incidental Mutation 'R4301:Vldlr'

322440

Institutional Source

Beutler Lab

Gene Symbol

Vldlr

Ensembl Gene

ENSMUSG00000024924

Gene Name

very low density lipoprotein receptor

Synonyms

AA408956, AI451093, AW047288, VLDL receptor

MMRRC Submission

041088-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.275) question?

Stock #

R4301 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27216484-27254231 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 27238402 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 266 (D266E)

Ref Sequence

ENSEMBL: ENSMUSP00000127329 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025866] [ENSMUST00000047645] [ENSMUST00000164746] [ENSMUST00000165761] [ENSMUST00000167487] [ENSMUST00000172302]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025866
AA Change: D266E

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000025866
Gene: ENSMUSG00000024924
AA Change: D266E

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
EGF_like	32	68	7.38e1	SMART
LDLa	32	69	1.69e-16	SMART
LDLa	71	110	5.81e-15	SMART
LDLa	112	151	1.96e-12	SMART
LDLa	153	190	7.15e-15	SMART
LDLa	192	231	1.23e-13	SMART
LDLa	238	275	1.1e-15	SMART
LDLa	277	314	1.13e-12	SMART
LDLa	317	357	3.86e-11	SMART
EGF_CA	356	395	1e-5	SMART
EGF_CA	396	435	6.1e-10	SMART
Blast:LY	461	495	4e-15	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000047645
AA Change: D225E

PolyPhen 2 Score 0.474 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000049145
Gene: ENSMUSG00000024924
AA Change: D225E

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
EGF_like	32	68	7.38e1	SMART
LDLa	32	69	1.69e-16	SMART
LDLa	71	110	1.25e-14	SMART
LDLa	112	149	7.15e-15	SMART
LDLa	151	190	1.23e-13	SMART
LDLa	197	234	1.1e-15	SMART
LDLa	236	273	1.13e-12	SMART
LDLa	276	316	3.86e-11	SMART
EGF_CA	315	354	1e-5	SMART
EGF_CA	355	394	6.1e-10	SMART
LY	420	462	2.16e-1	SMART
LY	464	506	9.54e-12	SMART
LY	507	550	2.22e-12	SMART
LY	551	593	1.66e-11	SMART
LY	594	637	5.97e-4	SMART
EGF	664	709	2.16e-1	SMART
transmembrane domain	728	750	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164509

Predicted Effect

probably benign
Transcript: ENSMUST00000164746

SMART Domains

Protein: ENSMUSP00000128193
Gene: ENSMUSG00000024924

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
LDLa	32	69	1.69e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000165761

SMART Domains

Protein: ENSMUSP00000130382
Gene: ENSMUSG00000024924

Domain	Start	End	E-Value	Type
LDLa	1	26	1.58e0	SMART
EGF	28	64	4e-5	SMART
LY	88	130	2.16e-1	SMART
LY	132	174	9.54e-12	SMART
LY	175	218	2.22e-12	SMART
LY	219	258	3.25e-5	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167487
AA Change: D266E

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000127329
Gene: ENSMUSG00000024924
AA Change: D266E

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
EGF_like	32	68	7.38e1	SMART
LDLa	32	69	1.69e-16	SMART
LDLa	71	110	5.81e-15	SMART
LDLa	112	151	1.96e-12	SMART
LDLa	153	190	7.15e-15	SMART
LDLa	192	231	1.23e-13	SMART
LDLa	238	275	1.1e-15	SMART
LDLa	277	314	1.13e-12	SMART
LDLa	317	357	3.86e-11	SMART
EGF_CA	356	395	1e-5	SMART
EGF_CA	396	435	6.1e-10	SMART
LY	461	503	2.16e-1	SMART
LY	505	547	9.54e-12	SMART
LY	548	591	2.22e-12	SMART
LY	592	634	1.66e-11	SMART
LY	635	678	5.97e-4	SMART
EGF	705	750	2.16e-1	SMART
transmembrane domain	797	819	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172302
AA Change: D266E

PolyPhen 2 Score 0.295 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000126730
Gene: ENSMUSG00000024924
AA Change: D266E

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
EGF_like	32	68	7.38e1	SMART
LDLa	32	69	1.69e-16	SMART
LDLa	71	110	5.81e-15	SMART
LDLa	112	151	1.96e-12	SMART
LDLa	153	190	7.15e-15	SMART
LDLa	192	231	1.23e-13	SMART
LDLa	238	275	1.1e-15	SMART
LDLa	277	314	1.13e-12	SMART
LDLa	317	357	3.86e-11	SMART
EGF_CA	356	395	1e-5	SMART
EGF_CA	396	435	6.1e-10	SMART
LY	461	503	2.16e-1	SMART
LY	505	547	9.54e-12	SMART
LY	548	591	2.22e-12	SMART
LY	592	634	1.66e-11	SMART
LY	635	678	5.97e-4	SMART
EGF	705	750	2.16e-1	SMART
transmembrane domain	769	791	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. This gene encodes a lipoprotein receptor that is a member of the LDLR family and plays important roles in VLDL-triglyceride metabolism and the reelin signaling pathway. Mutations in this gene cause VLDLR-associated cerebellar hypoplasia. Alternative splicing generates multiple transcript variants encoding distinct isoforms for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygous null mutants exhibit modest reductions in body weight and adiposity. In behavioral tests, mutants display deficits in contextual fear conditioning and long term potentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3bp	T	A	16: 56,556,903	V95D	probably damaging	Het
Adamtsl2	A	G	2: 27,087,283	D252G	probably null	Het
Adgra3	T	C	5: 49,961,078	R1043G	possibly damaging	Het
Atxn7l1	A	G	12: 33,367,238	D562G	probably damaging	Het
Ccdc70	T	C	8: 21,973,212	V6A	possibly damaging	Het
Cdc25a	T	C	9: 109,889,742	V337A	probably benign	Het
Chil4	G	A	3: 106,203,727	P284S	possibly damaging	Het
Crb1	A	G	1: 139,248,830	S472P	probably benign	Het
Fam193b	G	A	13: 55,542,604	R740*	probably null	Het
Fer	G	T	17: 64,078,910	L292F	probably damaging	Het
Gmppa	G	A	1: 75,442,496	R349H	possibly damaging	Het
Hspa1a	T	C	17: 34,970,506	I474V	probably benign	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906		probably benign	Het
Lrrc30	A	G	17: 67,632,568	S6P	probably damaging	Het
Lzts3	A	G	2: 130,636,438	S133P	probably damaging	Het
Mkl2	T	C	16: 13,398,305	Y294H	probably damaging	Het
Mtmr12	T	A	15: 12,236,020	F122I	possibly damaging	Het
Mypn	A	G	10: 63,118,484	Y124H	probably damaging	Het
Nfat5	T	C	8: 107,355,695		probably benign	Het
Npr2	T	C	4: 43,641,332		probably null	Het
Olfr1441	T	C	19: 12,422,717	L136P	probably damaging	Het
Pgm1	G	A	5: 64,103,797	W51*	probably null	Het
Phip	G	A	9: 82,959,713	R48*	probably null	Het
Piezo2	T	C	18: 63,084,840	T1075A	probably damaging	Het
Ppat	G	T	5: 76,928,501		probably benign	Het
Ppp2r2b	T	A	18: 42,898,746	E23D	probably null	Het
Prickle1	T	C	15: 93,508,636	I169V	possibly damaging	Het
Rab37	T	A	11: 115,158,564	D95E	possibly damaging	Het
Sash1	A	G	10: 8,751,470	V50A	probably benign	Het
Siae	C	A	9: 37,633,713	Q335K	possibly damaging	Het
Snx14	A	T	9: 88,410,623	I217K	probably damaging	Het
Son	A	G	16: 91,658,411	T1349A	possibly damaging	Het
Sptb	A	G	12: 76,612,697	L1143S	probably damaging	Het
Trim80	T	C	11: 115,445,113		probably null	Het
Trpm3	T	C	19: 22,987,292	S1374P	probably benign	Het
Vmn2r79	A	G	7: 87,001,891	H166R	possibly damaging	Het
Zbtb10	A	T	3: 9,265,160	Q526L	probably damaging	Het
Zfr2	T	C	10: 81,242,184		probably benign	Het
Zswim8	G	A	14: 20,713,909	R449H	possibly damaging	Het
Zzef1	T	C	11: 72,889,035	V1878A	probably damaging	Het

Other mutations in Vldlr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01346:Vldlr	APN	19	27239681	missense	possibly damaging	0.93
IGL01575:Vldlr	APN	19	27246631	missense	probably benign
IGL01626:Vldlr	APN	19	27243773	missense	probably damaging	1.00
IGL02213:Vldlr	APN	19	27241326	missense	probably benign	0.09
IGL02365:Vldlr	APN	19	27245625	missense	probably damaging	1.00
IGL02488:Vldlr	APN	19	27238275	missense	probably damaging	1.00
IGL02708:Vldlr	APN	19	27238085	missense	possibly damaging	0.92
IGL02947:Vldlr	APN	19	27239720	missense	probably benign	0.03
disturbed	UTSW	19	27238804	nonsense	probably null
r26	UTSW	19	27245654	missense	probably damaging	0.99
spotty	UTSW	19	27238792	missense	probably damaging	1.00
PIT4142001:Vldlr	UTSW	19	27234869	missense	probably benign	0.05
R0195:Vldlr	UTSW	19	27238386	missense	probably damaging	1.00
R0288:Vldlr	UTSW	19	27240651	splice site	probably benign
R0536:Vldlr	UTSW	19	27239964	missense	probably damaging	1.00
R0537:Vldlr	UTSW	19	27247918	missense	probably damaging	1.00
R0542:Vldlr	UTSW	19	27236255	missense	probably benign	0.01
R0594:Vldlr	UTSW	19	27234819	missense	probably damaging	1.00
R0624:Vldlr	UTSW	19	27238263	missense	possibly damaging	0.91
R0726:Vldlr	UTSW	19	27238386	missense	probably damaging	1.00
R1017:Vldlr	UTSW	19	27241333	missense	probably damaging	1.00
R1148:Vldlr	UTSW	19	27241291	missense	probably benign	0.01
R1148:Vldlr	UTSW	19	27241291	missense	probably benign	0.01
R1443:Vldlr	UTSW	19	27239721	missense	possibly damaging	0.91
R1493:Vldlr	UTSW	19	27241291	missense	probably benign	0.01
R1520:Vldlr	UTSW	19	27240543	missense	probably damaging	0.99
R1520:Vldlr	UTSW	19	27247066	missense	possibly damaging	0.96
R1657:Vldlr	UTSW	19	27245670	missense	probably benign	0.00
R1901:Vldlr	UTSW	19	27241309	missense	probably damaging	1.00
R2047:Vldlr	UTSW	19	27234838	missense	probably damaging	1.00
R2258:Vldlr	UTSW	19	27238386	missense	probably damaging	1.00
R2273:Vldlr	UTSW	19	27248015	missense	probably damaging	1.00
R2423:Vldlr	UTSW	19	27236288	missense	possibly damaging	0.49
R3196:Vldlr	UTSW	19	27243154	missense	probably damaging	0.98
R3752:Vldlr	UTSW	19	27238331	missense	probably damaging	1.00
R3801:Vldlr	UTSW	19	27217621	missense	probably damaging	0.99
R3835:Vldlr	UTSW	19	27234814	missense	probably damaging	1.00
R4027:Vldlr	UTSW	19	27238313	missense	probably benign
R4470:Vldlr	UTSW	19	27234819	missense	probably damaging	0.96
R4541:Vldlr	UTSW	19	27238792	missense	probably damaging	1.00
R4765:Vldlr	UTSW	19	27240547	missense	probably damaging	1.00
R4771:Vldlr	UTSW	19	27239890	missense	probably damaging	0.97
R4795:Vldlr	UTSW	19	27238852	splice site	probably null
R4839:Vldlr	UTSW	19	27238065	missense	probably damaging	1.00
R5074:Vldlr	UTSW	19	27238277	missense	probably damaging	1.00
R5134:Vldlr	UTSW	19	27238812	nonsense	probably null
R5281:Vldlr	UTSW	19	27244231	missense	probably benign	0.44
R5466:Vldlr	UTSW	19	27239843	critical splice acceptor site	probably null
R5514:Vldlr	UTSW	19	27244224	missense	probably damaging	0.97
R5886:Vldlr	UTSW	19	27243771	missense	probably benign	0.03
R5889:Vldlr	UTSW	19	27239664	missense	probably damaging	1.00
R6110:Vldlr	UTSW	19	27238077	missense	possibly damaging	0.92
R6343:Vldlr	UTSW	19	27245649	missense	probably damaging	0.99
R6833:Vldlr	UTSW	19	27240574	missense	probably damaging	1.00
R6838:Vldlr	UTSW	19	27247970	missense	probably damaging	1.00
R7169:Vldlr	UTSW	19	27244328	missense	probably benign
R7197:Vldlr	UTSW	19	27234841	missense	probably benign	0.36
R7304:Vldlr	UTSW	19	27238604	missense	possibly damaging	0.93
R7403:Vldlr	UTSW	19	27236274	nonsense	probably null
R7658:Vldlr	UTSW	19	27243136	missense	probably benign	0.33
R7754:Vldlr	UTSW	19	27217615	start codon destroyed	probably benign	0.01
R8105:Vldlr	UTSW	19	27238804	nonsense	probably null
R8377:Vldlr	UTSW	19	27234858	missense	probably damaging	1.00
R8529:Vldlr	UTSW	19	27230256	missense	probably benign	0.03
R8777:Vldlr	UTSW	19	27240546	missense	probably benign	0.00
R8777-TAIL:Vldlr	UTSW	19	27240546	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGTGATGAGCTGGACTGTGC -3'
(R):5'- TCAACACAGTCTCGGATGCC -3'

Sequencing Primer
(F):5'- AGTTCCAGTGCAGCACCTC -3'
(R):5'- ACAGTCTCGGATGCCATTGC -3'

Posted On

2015-06-20