Incidental Mutation 'R4302:Gm973'
ID322441
Institutional Source Beutler Lab
Gene Symbol Gm973
Ensembl Gene ENSMUSG00000047361
Gene Namepredicted gene 973
SynonymsLOC381260
MMRRC Submission 041089-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R4302 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location59516264-59636417 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59551240 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 302 (Y302C)
Ref Sequence ENSEMBL: ENSMUSP00000109881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114243] [ENSMUST00000186434]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114243
AA Change: Y302C

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109881
Gene: ENSMUSG00000047361
AA Change: Y302C

DomainStartEndE-ValueType
low complexity region 364 375 N/A INTRINSIC
Pfam:DUF4670 583 1045 7.3e-160 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186310
Predicted Effect unknown
Transcript: ENSMUST00000186434
AA Change: Y301C
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189864
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191318
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,746,630 Y1445C probably damaging Het
Arhgef12 G A 9: 43,018,349 Q217* probably null Het
Bcas1 A G 2: 170,418,627 V44A probably benign Het
Clic4 A G 4: 135,226,039 V98A probably benign Het
Col6a3 A T 1: 90,807,614 I771N probably damaging Het
Creb3l1 T C 2: 91,993,319 I183V probably damaging Het
Dnhd1 T A 7: 105,693,954 W1502R probably damaging Het
Dync2h1 A T 9: 7,077,880 S2941T probably benign Het
Hcfc1 A G X: 73,949,366 S1398P probably benign Het
Igsf10 T C 3: 59,318,750 I2501V probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Loxl4 T A 19: 42,607,591 Y141F probably benign Het
Man2a2 T A 7: 80,351,739 E1140V possibly damaging Het
Mgam A G 6: 40,763,085 D1664G probably benign Het
Mill2 A T 7: 18,856,531 T179S probably damaging Het
Ncf4 T C 15: 78,260,762 probably benign Het
Nol12 T C 15: 78,940,141 S154P probably damaging Het
Nupl1 A G 14: 60,247,426 S50P probably benign Het
Olfr106-ps T A 17: 37,395,486 N315K probably benign Het
Olfr736 T C 14: 50,393,446 I230T probably benign Het
Olfr849 A G 9: 19,440,999 T29A probably benign Het
Pdss1 T C 2: 22,915,505 I265T probably damaging Het
Piezo2 T C 18: 63,124,730 probably null Het
Rad50 T A 11: 53,702,005 N106I probably benign Het
Rhpn2 A G 7: 35,390,845 T631A probably benign Het
Rps11 T C 7: 45,122,944 M80V probably benign Het
Rrm1 T C 7: 102,447,824 Y104H probably benign Het
Sgsm3 T A 15: 81,010,301 probably benign Het
Slc9c1 A T 16: 45,544,791 L162F probably benign Het
Son A G 16: 91,658,411 T1349A possibly damaging Het
Stk24 A G 14: 121,292,082 L386S probably benign Het
Tfcp2 G T 15: 100,514,849 N307K possibly damaging Het
Trbv21 T A 6: 41,202,768 V6D probably benign Het
Trip11 A T 12: 101,893,768 D282E probably damaging Het
Ttn G T 2: 76,876,467 probably benign Het
Vmn2r38 A G 7: 9,097,563 probably null Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps8 T A 16: 21,495,914 L158Q probably damaging Het
Wdr66 T C 5: 123,293,810 I549T probably benign Het
Other mutations in Gm973
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Gm973 APN 1 59630279 missense probably benign 0.00
IGL01732:Gm973 APN 1 59630237 missense probably benign 0.24
IGL02124:Gm973 APN 1 59582473 nonsense probably null
IGL02251:Gm973 APN 1 59582423 missense probably benign 0.18
IGL02818:Gm973 APN 1 59541475 critical splice donor site probably null
IGL03385:Gm973 APN 1 59582470 missense probably benign 0.14
R0105:Gm973 UTSW 1 59582474 missense probably null 0.60
R0105:Gm973 UTSW 1 59582474 missense probably null 0.60
R0280:Gm973 UTSW 1 59544680 frame shift probably null
R0490:Gm973 UTSW 1 59558234 splice site probably benign
R0491:Gm973 UTSW 1 59558234 splice site probably benign
R0508:Gm973 UTSW 1 59582490 splice site probably benign
R0636:Gm973 UTSW 1 59551144 missense probably benign 0.13
R0709:Gm973 UTSW 1 59558234 splice site probably benign
R0900:Gm973 UTSW 1 59566668 missense probably benign 0.00
R1758:Gm973 UTSW 1 59634010 missense unknown
R1816:Gm973 UTSW 1 59582399 missense probably damaging 0.99
R1975:Gm973 UTSW 1 59562771 missense possibly damaging 0.50
R2166:Gm973 UTSW 1 59526739 missense possibly damaging 0.61
R3052:Gm973 UTSW 1 59633140 splice site probably benign
R3899:Gm973 UTSW 1 59625140 missense probably benign 0.00
R4181:Gm973 UTSW 1 59551240 missense possibly damaging 0.93
R4623:Gm973 UTSW 1 59556276 missense probably damaging 1.00
R4642:Gm973 UTSW 1 59558114 missense probably damaging 1.00
R4716:Gm973 UTSW 1 59552554 nonsense probably null
R4920:Gm973 UTSW 1 59627566 missense probably benign
R4951:Gm973 UTSW 1 59541474 critical splice donor site probably null
R5214:Gm973 UTSW 1 59526721 missense probably damaging 1.00
R5225:Gm973 UTSW 1 59562700 missense probably benign 0.01
R5472:Gm973 UTSW 1 59628287 splice site probably null
R5554:Gm973 UTSW 1 59526972 missense probably benign 0.09
R5709:Gm973 UTSW 1 59552555 missense possibly damaging 0.73
R5886:Gm973 UTSW 1 59558250 intron probably benign
R6044:Gm973 UTSW 1 59628234 missense probably benign
R6046:Gm973 UTSW 1 59632350 missense unknown
R6818:Gm973 UTSW 1 59630169 missense probably damaging 0.99
R6920:Gm973 UTSW 1 59552461 missense possibly damaging 0.76
R6999:Gm973 UTSW 1 59634092 missense unknown
R7214:Gm973 UTSW 1 59562729 nonsense probably null
R7418:Gm973 UTSW 1 59526813 missense probably damaging 1.00
R7780:Gm973 UTSW 1 59558130 missense probably damaging 1.00
Z1176:Gm973 UTSW 1 59524602 start gained probably benign
Z1177:Gm973 UTSW 1 59541330 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTCCCCATTCCTCAGAGAG -3'
(R):5'- GGACTCTGCTATTCTCAAGGGC -3'

Sequencing Primer
(F):5'- GGATCCACATGGTCTGACTTACAG -3'
(R):5'- CTATTCTCAAGGGCGAGTGGC -3'
Posted On2015-06-20