Incidental Mutation 'R4302:Clic4'
ID322449
Institutional Source Beutler Lab
Gene Symbol Clic4
Ensembl Gene ENSMUSG00000037242
Gene Namechloride intracellular channel 4 (mitochondrial)
SynonymsD0Jmb3, mc3s5, mtCLIC
MMRRC Submission 041089-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4302 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location135213969-135272814 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135226039 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 98 (V98A)
Ref Sequence ENSEMBL: ENSMUSP00000041453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037099]
Predicted Effect probably benign
Transcript: ENSMUST00000037099
AA Change: V98A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000041453
Gene: ENSMUSG00000037242
AA Change: V98A

DomainStartEndE-ValueType
Pfam:GST_N_3 31 103 7.3e-9 PFAM
Pfam:GST_C_2 134 223 2.7e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143370
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chloride channels are a diverse group of proteins that regulate fundamental cellular processes including stabilization of cell membrane potential, transepithelial transport, maintenance of intracellular pH, and regulation of cell volume. Chloride intracellular channel 4 (CLIC4) protein, encoded by the CLIC4 gene, is a member of the p64 family; the gene is expressed in many tissues and exhibits a intracellular vesicular pattern in Panc-1 cells (pancreatic cancer cells). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null mutations may display decreased survival, body weight and female fertility, impaired angiogenesis, increased suscpetibility to Listeria infection, increased resistance to LPS treatment, skin erosions and/or delayed wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,746,630 Y1445C probably damaging Het
Arhgef12 G A 9: 43,018,349 Q217* probably null Het
Bcas1 A G 2: 170,418,627 V44A probably benign Het
Col6a3 A T 1: 90,807,614 I771N probably damaging Het
Creb3l1 T C 2: 91,993,319 I183V probably damaging Het
Dnhd1 T A 7: 105,693,954 W1502R probably damaging Het
Dync2h1 A T 9: 7,077,880 S2941T probably benign Het
Gm973 A G 1: 59,551,240 Y302C possibly damaging Het
Hcfc1 A G X: 73,949,366 S1398P probably benign Het
Igsf10 T C 3: 59,318,750 I2501V probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Loxl4 T A 19: 42,607,591 Y141F probably benign Het
Man2a2 T A 7: 80,351,739 E1140V possibly damaging Het
Mgam A G 6: 40,763,085 D1664G probably benign Het
Mill2 A T 7: 18,856,531 T179S probably damaging Het
Ncf4 T C 15: 78,260,762 probably benign Het
Nol12 T C 15: 78,940,141 S154P probably damaging Het
Nupl1 A G 14: 60,247,426 S50P probably benign Het
Olfr106-ps T A 17: 37,395,486 N315K probably benign Het
Olfr736 T C 14: 50,393,446 I230T probably benign Het
Olfr849 A G 9: 19,440,999 T29A probably benign Het
Pdss1 T C 2: 22,915,505 I265T probably damaging Het
Piezo2 T C 18: 63,124,730 probably null Het
Rad50 T A 11: 53,702,005 N106I probably benign Het
Rhpn2 A G 7: 35,390,845 T631A probably benign Het
Rps11 T C 7: 45,122,944 M80V probably benign Het
Rrm1 T C 7: 102,447,824 Y104H probably benign Het
Sgsm3 T A 15: 81,010,301 probably benign Het
Slc9c1 A T 16: 45,544,791 L162F probably benign Het
Son A G 16: 91,658,411 T1349A possibly damaging Het
Stk24 A G 14: 121,292,082 L386S probably benign Het
Tfcp2 G T 15: 100,514,849 N307K possibly damaging Het
Trbv21 T A 6: 41,202,768 V6D probably benign Het
Trip11 A T 12: 101,893,768 D282E probably damaging Het
Ttn G T 2: 76,876,467 probably benign Het
Vmn2r38 A G 7: 9,097,563 probably null Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps8 T A 16: 21,495,914 L158Q probably damaging Het
Wdr66 T C 5: 123,293,810 I549T probably benign Het
Other mutations in Clic4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01564:Clic4 APN 4 135217193 missense probably damaging 0.99
IGL01674:Clic4 APN 4 135238893 missense probably benign 0.01
IGL03343:Clic4 APN 4 135218578 missense possibly damaging 0.91
IGL03372:Clic4 APN 4 135218614 missense probably damaging 0.99
R1643:Clic4 UTSW 4 135238895 missense possibly damaging 0.69
R2201:Clic4 UTSW 4 135223539 missense probably damaging 1.00
R4181:Clic4 UTSW 4 135226039 missense probably benign 0.00
R4335:Clic4 UTSW 4 135218605 missense probably benign 0.15
R4600:Clic4 UTSW 4 135238989 intron probably null
R4939:Clic4 UTSW 4 135223541 missense probably benign 0.16
R5359:Clic4 UTSW 4 135217135 missense probably benign 0.00
R5437:Clic4 UTSW 4 135217246 missense probably damaging 1.00
R5902:Clic4 UTSW 4 135272558 missense probably benign
R7670:Clic4 UTSW 4 135217205 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATTCTGCCACTGACTAAGC -3'
(R):5'- TCTCATTGCAGTGCTGTGC -3'

Sequencing Primer
(F):5'- AAGCATTACTCTTACAAGCGTGTCC -3'
(R):5'- GACTTGCCCCACTGAGAACTTG -3'
Posted On2015-06-20