Incidental Mutation 'R4302:Mgam'
Institutional Source Beutler Lab
Gene Symbol Mgam
Ensembl Gene ENSMUSG00000068587
Gene Namemaltase-glucoamylase
MMRRC Submission 041089-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R4302 (G1)
Quality Score225
Status Validated
Chromosomal Location40628831-40769123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40763085 bp
Amino Acid Change Aspartic acid to Glycine at position 1664 (D1664G)
Ref Sequence ENSEMBL: ENSMUSP00000143946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071535] [ENSMUST00000201148] [ENSMUST00000202779] [ENSMUST00000202966]
Predicted Effect probably benign
Transcript: ENSMUST00000071535
AA Change: D1664G

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000071466
Gene: ENSMUSG00000068587
AA Change: D1664G

transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201148
AA Change: D1664G

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000143946
Gene: ENSMUSG00000068587
AA Change: D1664G

transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202775
Predicted Effect probably benign
Transcript: ENSMUST00000202779
AA Change: D1037G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000144627
Gene: ENSMUSG00000068587
AA Change: D1037G

Pfam:Glyco_hydro_31 2 170 1.4e-53 PFAM
PD 297 350 1.4e-14 SMART
Pfam:NtCtMGAM_N 361 474 1.5e-26 PFAM
Blast:ANK 514 544 7e-8 BLAST
Pfam:Glyco_hydro_31 562 1064 2.2e-137 PFAM
low complexity region 1149 1164 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202966
AA Change: D918G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000144680
Gene: ENSMUSG00000068587
AA Change: D918G

internal_repeat_1 2 88 2.6e-19 PROSPERO
PD 178 231 1.4e-14 SMART
Pfam:NtCtMGAM_N 242 355 1.1e-26 PFAM
Blast:ANK 395 425 6e-8 BLAST
Pfam:Glyco_hydro_31 443 945 1.3e-137 PFAM
Meta Mutation Damage Score 0.1312 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes maltase-glucoamylase, which is a brush border membrane enzyme that plays a role in the final steps of digestion of starch. The protein has two catalytic sites identical to those of sucrase-isomaltase, but the proteins are only 59% homologous. Both are members of glycosyl hydrolase family 31, which has a variety of substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in starch digestion and prandial glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,746,630 Y1445C probably damaging Het
Arhgef12 G A 9: 43,018,349 Q217* probably null Het
Bcas1 A G 2: 170,418,627 V44A probably benign Het
Clic4 A G 4: 135,226,039 V98A probably benign Het
Col6a3 A T 1: 90,807,614 I771N probably damaging Het
Creb3l1 T C 2: 91,993,319 I183V probably damaging Het
Dnhd1 T A 7: 105,693,954 W1502R probably damaging Het
Dync2h1 A T 9: 7,077,880 S2941T probably benign Het
Gm973 A G 1: 59,551,240 Y302C possibly damaging Het
Hcfc1 A G X: 73,949,366 S1398P probably benign Het
Igsf10 T C 3: 59,318,750 I2501V probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Loxl4 T A 19: 42,607,591 Y141F probably benign Het
Man2a2 T A 7: 80,351,739 E1140V possibly damaging Het
Mill2 A T 7: 18,856,531 T179S probably damaging Het
Ncf4 T C 15: 78,260,762 probably benign Het
Nol12 T C 15: 78,940,141 S154P probably damaging Het
Nupl1 A G 14: 60,247,426 S50P probably benign Het
Olfr106-ps T A 17: 37,395,486 N315K probably benign Het
Olfr736 T C 14: 50,393,446 I230T probably benign Het
Olfr849 A G 9: 19,440,999 T29A probably benign Het
Pdss1 T C 2: 22,915,505 I265T probably damaging Het
Piezo2 T C 18: 63,124,730 probably null Het
Rad50 T A 11: 53,702,005 N106I probably benign Het
Rhpn2 A G 7: 35,390,845 T631A probably benign Het
Rps11 T C 7: 45,122,944 M80V probably benign Het
Rrm1 T C 7: 102,447,824 Y104H probably benign Het
Sgsm3 T A 15: 81,010,301 probably benign Het
Slc9c1 A T 16: 45,544,791 L162F probably benign Het
Son A G 16: 91,658,411 T1349A possibly damaging Het
Stk24 A G 14: 121,292,082 L386S probably benign Het
Tfcp2 G T 15: 100,514,849 N307K possibly damaging Het
Trbv21 T A 6: 41,202,768 V6D probably benign Het
Trip11 A T 12: 101,893,768 D282E probably damaging Het
Ttn G T 2: 76,876,467 probably benign Het
Vmn2r38 A G 7: 9,097,563 probably null Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps8 T A 16: 21,495,914 L158Q probably damaging Het
Wdr66 T C 5: 123,293,810 I549T probably benign Het
Other mutations in Mgam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Mgam APN 6 40643010 missense probably benign
IGL01065:Mgam APN 6 40662710 critical splice donor site probably null
IGL01402:Mgam APN 6 40644945 missense probably benign 0.01
IGL01404:Mgam APN 6 40644945 missense probably benign 0.01
IGL01413:Mgam APN 6 40661277 missense probably damaging 1.00
IGL01546:Mgam APN 6 40654693 missense probably damaging 0.98
IGL01596:Mgam APN 6 40658270 missense probably damaging 1.00
IGL02133:Mgam APN 6 40643076 missense probably damaging 0.98
IGL02734:Mgam APN 6 40662694 missense probably damaging 1.00
BB002:Mgam UTSW 6 40759051 missense probably damaging 0.99
BB012:Mgam UTSW 6 40759051 missense probably damaging 0.99
R0012:Mgam UTSW 6 40765256 splice site probably null
R0116:Mgam UTSW 6 40658987 missense probably damaging 1.00
R0310:Mgam UTSW 6 40761035 splice site probably benign
R0452:Mgam UTSW 6 40759090 missense probably damaging 1.00
R0497:Mgam UTSW 6 40664892 missense probably damaging 1.00
R0699:Mgam UTSW 6 40643019 missense possibly damaging 0.84
R0738:Mgam UTSW 6 40754935 missense probably benign 0.01
R1033:Mgam UTSW 6 40680624 missense probably benign 0.07
R1403:Mgam UTSW 6 40666881 missense possibly damaging 0.93
R1403:Mgam UTSW 6 40666881 missense possibly damaging 0.93
R1430:Mgam UTSW 6 40756371 missense probably benign 0.08
R1432:Mgam UTSW 6 40756367 missense probably damaging 1.00
R1443:Mgam UTSW 6 40759780 nonsense probably null
R1470:Mgam UTSW 6 40759128 missense probably damaging 1.00
R1470:Mgam UTSW 6 40759128 missense probably damaging 1.00
R1519:Mgam UTSW 6 40661683 missense probably benign 0.45
R1654:Mgam UTSW 6 40757487 missense probably damaging 1.00
R1667:Mgam UTSW 6 40677044 missense possibly damaging 0.62
R1730:Mgam UTSW 6 40664860 missense possibly damaging 0.92
R1781:Mgam UTSW 6 40669863 missense probably damaging 1.00
R1783:Mgam UTSW 6 40664860 missense possibly damaging 0.92
R1829:Mgam UTSW 6 40666892 missense probably damaging 1.00
R1833:Mgam UTSW 6 40654718 critical splice donor site probably null
R1872:Mgam UTSW 6 40661300 nonsense probably null
R1912:Mgam UTSW 6 40764185 nonsense probably null
R1977:Mgam UTSW 6 40664880 missense probably benign 0.01
R2048:Mgam UTSW 6 40656429 missense possibly damaging 0.80
R2086:Mgam UTSW 6 40761028 splice site probably null
R2138:Mgam UTSW 6 40756450 missense probably damaging 1.00
R2224:Mgam UTSW 6 40764274 splice site probably null
R2408:Mgam UTSW 6 40686522 missense probably damaging 1.00
R2508:Mgam UTSW 6 40759783 missense probably damaging 1.00
R2842:Mgam UTSW 6 40661345 missense probably benign 0.01
R2847:Mgam UTSW 6 40652715 missense possibly damaging 0.67
R2848:Mgam UTSW 6 40652715 missense possibly damaging 0.67
R2965:Mgam UTSW 6 40768220 missense possibly damaging 0.46
R2966:Mgam UTSW 6 40768220 missense possibly damaging 0.46
R3035:Mgam UTSW 6 40663530 missense probably benign
R3895:Mgam UTSW 6 40759120 missense probably damaging 1.00
R4027:Mgam UTSW 6 40754902 missense probably damaging 1.00
R4030:Mgam UTSW 6 40754902 missense probably damaging 1.00
R4707:Mgam UTSW 6 40714632 splice site probably null
R4826:Mgam UTSW 6 40680648 missense possibly damaging 0.52
R4898:Mgam UTSW 6 40643054 missense probably benign
R5438:Mgam UTSW 6 40684521 missense probably damaging 1.00
R5492:Mgam UTSW 6 40756363 missense probably damaging 1.00
R5770:Mgam UTSW 6 40669804 missense probably benign 0.01
R5839:Mgam UTSW 6 40740064 missense possibly damaging 0.90
R5845:Mgam UTSW 6 40675323 missense possibly damaging 0.78
R5847:Mgam UTSW 6 40684055 missense probably benign 0.42
R5891:Mgam UTSW 6 40744348 missense probably benign
R6158:Mgam UTSW 6 40757714 missense probably damaging 1.00
R6193:Mgam UTSW 6 40747920 nonsense probably null
R6423:Mgam UTSW 6 40677045 missense possibly damaging 0.84
R6706:Mgam UTSW 6 40744786 missense probably benign 0.00
R6813:Mgam UTSW 6 40750165 missense probably damaging 0.99
R6863:Mgam UTSW 6 40729009 missense probably benign 0.00
R6906:Mgam UTSW 6 40747919 missense probably damaging 1.00
R7091:Mgam UTSW 6 40768276 missense possibly damaging 0.95
R7099:Mgam UTSW 6 40661716 missense probably benign 0.09
R7282:Mgam UTSW 6 40656512 missense possibly damaging 0.71
R7282:Mgam UTSW 6 40763111 missense probably benign
R7354:Mgam UTSW 6 40744798 missense probably damaging 1.00
R7374:Mgam UTSW 6 40757439 missense possibly damaging 0.89
R7399:Mgam UTSW 6 40666854 missense probably damaging 0.99
R7406:Mgam UTSW 6 40663525 missense probably benign 0.13
R7446:Mgam UTSW 6 40746332 missense probably damaging 1.00
R7466:Mgam UTSW 6 40744789 missense probably benign 0.00
R7525:Mgam UTSW 6 40766020 missense probably benign 0.01
R7530:Mgam UTSW 6 40709218 splice site probably null
R7570:Mgam UTSW 6 40746433 missense probably benign 0.16
R7669:Mgam UTSW 6 40659010 missense probably benign 0.00
R7679:Mgam UTSW 6 40643046 missense probably damaging 0.98
R7746:Mgam UTSW 6 40668193 missense probably damaging 0.99
R7859:Mgam UTSW 6 40740179 missense possibly damaging 0.75
R7925:Mgam UTSW 6 40759051 missense probably damaging 0.99
R8206:Mgam UTSW 6 40680235 missense probably benign 0.00
R8244:Mgam UTSW 6 40750586 missense probably damaging 1.00
R8309:Mgam UTSW 6 40745177 missense possibly damaging 0.88
R8472:Mgam UTSW 6 40694526 splice site probably null
R8758:Mgam UTSW 6 40729043 missense probably benign 0.41
R8777:Mgam UTSW 6 40655251 missense probably damaging 0.97
R8777-TAIL:Mgam UTSW 6 40655251 missense probably damaging 0.97
R8783:Mgam UTSW 6 40656489 missense probably damaging 0.99
RF011:Mgam UTSW 6 40757436 missense probably damaging 1.00
RF020:Mgam UTSW 6 40685309 missense probably damaging 1.00
RF023:Mgam UTSW 6 40680708 missense probably benign
X0021:Mgam UTSW 6 40659047 missense probably damaging 1.00
Z1088:Mgam UTSW 6 40643060 missense probably benign 0.01
Z1176:Mgam UTSW 6 40677644 critical splice donor site probably null
Z1176:Mgam UTSW 6 40729066 missense probably damaging 1.00
Z1177:Mgam UTSW 6 40740071 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-06-20