Mutagenetix > Incidental Mutations

Incidental Mutation 'R4302:Rrm1'

322458

Institutional Source

Beutler Lab

Gene Symbol

Rrm1

Ensembl Gene

ENSMUSG00000030978

Gene Name

ribonucleotide reductase M1

Synonyms

RnrM1

MMRRC Submission

041089-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.969) question?

Stock #

R4302 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102441695-102469771 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 102447824 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 104 (Y104H)

Ref Sequence

ENSEMBL: ENSMUSP00000033283 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033283] [ENSMUST00000211720]

AlphaFold

P07742

Predicted Effect

probably benign
Transcript: ENSMUST00000033283
AA Change: Y104H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000033283
Gene: ENSMUSG00000030978
AA Change: Y104H

Domain	Start	End	E-Value	Type
Pfam:ATP-cone	1	89	8.7e-21	PFAM
Pfam:Ribonuc_red_lgN	141	213	2.8e-25	PFAM
Pfam:Ribonuc_red_lgC	216	738	1.6e-197	PFAM
coiled coil region	749	778	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210751

Predicted Effect

probably benign
Transcript: ENSMUST00000211720

Meta Mutation Damage Score

0.1202

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the large and catalytic subunit of ribonucleotide reductase, an enzyme essential for the conversion of ribonucleotides into deoxyribonucleotides. A pool of available deoxyribonucleotides is important for DNA replication during S phase of the cell cycle as well as multiple DNA repair processes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic letahlity before E3.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agl	T	C	3: 116,746,630	Y1445C	probably damaging	Het
Arhgef12	G	A	9: 43,018,349	Q217*	probably null	Het
Bcas1	A	G	2: 170,418,627	V44A	probably benign	Het
Clic4	A	G	4: 135,226,039	V98A	probably benign	Het
Col6a3	A	T	1: 90,807,614	I771N	probably damaging	Het
Creb3l1	T	C	2: 91,993,319	I183V	probably damaging	Het
Dnhd1	T	A	7: 105,693,954	W1502R	probably damaging	Het
Dync2h1	A	T	9: 7,077,880	S2941T	probably benign	Het
Gm973	A	G	1: 59,551,240	Y302C	possibly damaging	Het
Hcfc1	A	G	X: 73,949,366	S1398P	probably benign	Het
Igsf10	T	C	3: 59,318,750	I2501V	probably damaging	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906	74	probably benign	Het
Loxl4	T	A	19: 42,607,591	Y141F	probably benign	Het
Man2a2	T	A	7: 80,351,739	E1140V	possibly damaging	Het
Mgam	A	G	6: 40,763,085	D1664G	probably benign	Het
Mill2	A	T	7: 18,856,531	T179S	probably damaging	Het
Ncf4	T	C	15: 78,260,762		probably benign	Het
Nol12	T	C	15: 78,940,141	S154P	probably damaging	Het
Nupl1	A	G	14: 60,247,426	S50P	probably benign	Het
Olfr106-ps	T	A	17: 37,395,486	N315K	probably benign	Het
Olfr736	T	C	14: 50,393,446	I230T	probably benign	Het
Olfr849	A	G	9: 19,440,999	T29A	probably benign	Het
Pdss1	T	C	2: 22,915,505	I265T	probably damaging	Het
Piezo2	T	C	18: 63,124,730		probably null	Het
Rad50	T	A	11: 53,702,005	N106I	probably benign	Het
Rhpn2	A	G	7: 35,390,845	T631A	probably benign	Het
Rps11	T	C	7: 45,122,944	M80V	probably benign	Het
Sgsm3	T	A	15: 81,010,301		probably benign	Het
Slc9c1	A	T	16: 45,544,791	L162F	probably benign	Het
Son	A	G	16: 91,658,411	T1349A	possibly damaging	Het
Stk24	A	G	14: 121,292,082	L386S	probably benign	Het
Tfcp2	G	T	15: 100,514,849	N307K	possibly damaging	Het
Trbv21	T	A	6: 41,202,768	V6D	probably benign	Het
Trip11	A	T	12: 101,893,768	D282E	probably damaging	Het
Ttn	G	T	2: 76,876,467		probably benign	Het
Vmn2r38	A	G	7: 9,097,563		probably null	Het
Vmn2r-ps159	G	T	4: 156,334,397		noncoding transcript	Het
Vps8	T	A	16: 21,495,914	L158Q	probably damaging	Het
Wdr66	T	C	5: 123,293,810	I549T	probably benign	Het

Other mutations in Rrm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Rrm1	APN	7	102454507	nonsense	probably null
IGL01431:Rrm1	APN	7	102457552	splice site	probably benign
IGL03251:Rrm1	APN	7	102457206	missense	probably damaging	1.00
IGL03401:Rrm1	APN	7	102465744	missense	possibly damaging	0.81
Arabica	UTSW	7	102460351	missense	probably damaging	1.00
Pentose	UTSW	7	102460856	splice site	probably null
R0454:Rrm1	UTSW	7	102466926	missense	probably damaging	1.00
R0548:Rrm1	UTSW	7	102467067	critical splice donor site	probably null
R0759:Rrm1	UTSW	7	102457561	missense	probably benign	0.32
R1575:Rrm1	UTSW	7	102456514	missense	probably damaging	1.00
R1586:Rrm1	UTSW	7	102466905	makesense	probably null
R1625:Rrm1	UTSW	7	102468347	missense	probably damaging	0.98
R2207:Rrm1	UTSW	7	102442026	start codon destroyed	probably null	0.98
R2432:Rrm1	UTSW	7	102443072	missense	probably benign	0.03
R2513:Rrm1	UTSW	7	102460689	missense	probably damaging	0.99
R3796:Rrm1	UTSW	7	102465703	splice site	probably null
R3914:Rrm1	UTSW	7	102457174	missense	probably damaging	1.00
R4179:Rrm1	UTSW	7	102457198	missense	probably damaging	1.00
R4379:Rrm1	UTSW	7	102446593	missense	probably damaging	1.00
R4416:Rrm1	UTSW	7	102447801	missense	probably benign	0.06
R4690:Rrm1	UTSW	7	102447879	missense	probably benign
R4939:Rrm1	UTSW	7	102466924	missense	probably benign	0.34
R5433:Rrm1	UTSW	7	102465767	missense	probably damaging	0.97
R5445:Rrm1	UTSW	7	102451023	missense	possibly damaging	0.77
R6120:Rrm1	UTSW	7	102460856	splice site	probably null
R6198:Rrm1	UTSW	7	102446729	critical splice donor site	probably null
R6369:Rrm1	UTSW	7	102446702	missense	probably damaging	0.97
R6699:Rrm1	UTSW	7	102460825	missense	probably damaging	1.00
R7009:Rrm1	UTSW	7	102460334	missense	probably damaging	1.00
R7491:Rrm1	UTSW	7	102454557	missense	probably damaging	1.00
R8024:Rrm1	UTSW	7	102457265	missense	probably benign	0.00
R8276:Rrm1	UTSW	7	102460852	critical splice donor site	probably null
R8713:Rrm1	UTSW	7	102460351	missense	probably damaging	1.00
R8963:Rrm1	UTSW	7	102456532	missense	probably benign	0.23
R8968:Rrm1	UTSW	7	102468338	missense	probably benign	0.03
R9028:Rrm1	UTSW	7	102460398	missense	probably damaging	1.00
R9442:Rrm1	UTSW	7	102459391	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGAATTGCTGATAAGCTATAAGACC -3'
(R):5'- GTCTTCAAGATTATGACCAGGGTGA -3'

Sequencing Primer
(F):5'- GGTTGGTACTAAGCAAGG -3'
(R):5'- TTCAGAGGACCAGGGTTCAATTCC -3'

Posted On

2015-06-20