Incidental Mutation 'R4302:Hcfc1'
ID322478
Institutional Source Beutler Lab
Gene Symbol Hcfc1
Ensembl Gene ENSMUSG00000031386
Gene Namehost cell factor C1
SynonymsHCF-1, HCF1, VP16 accessory protein
MMRRC Submission 041089-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R4302 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location73942792-73966357 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73949366 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1398 (S1398P)
Ref Sequence ENSEMBL: ENSMUSP00000033761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033761] [ENSMUST00000114372]
PDB Structure
NMR structure of the C-terminal domain of the protein HCFC1 from Mus musculus [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000033761
AA Change: S1398P

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000033761
Gene: ENSMUSG00000031386
AA Change: S1398P

DomainStartEndE-ValueType
Pfam:Kelch_1 32 71 4.3e-7 PFAM
Pfam:Kelch_4 32 81 4.5e-6 PFAM
Pfam:Kelch_3 91 145 5.6e-8 PFAM
Pfam:Kelch_3 146 208 1.5e-6 PFAM
Pfam:Kelch_4 199 254 5.6e-6 PFAM
Pfam:Kelch_3 215 263 2.4e-8 PFAM
Pfam:Kelch_1 254 309 7.5e-8 PFAM
Pfam:Kelch_3 264 330 1.1e-7 PFAM
Pfam:Kelch_5 318 363 7.4e-7 PFAM
Blast:FN3 364 536 5e-61 BLAST
Blast:FN3 538 602 5e-6 BLAST
low complexity region 639 658 N/A INTRINSIC
Blast:FN3 740 932 8e-29 BLAST
low complexity region 933 950 N/A INTRINSIC
internal_repeat_2 975 1018 8.95e-6 PROSPERO
low complexity region 1019 1036 N/A INTRINSIC
internal_repeat_2 1040 1080 8.95e-6 PROSPERO
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1114 1130 N/A INTRINSIC
low complexity region 1135 1149 N/A INTRINSIC
low complexity region 1164 1182 N/A INTRINSIC
low complexity region 1235 1247 N/A INTRINSIC
low complexity region 1273 1282 N/A INTRINSIC
low complexity region 1308 1321 N/A INTRINSIC
low complexity region 1332 1346 N/A INTRINSIC
low complexity region 1349 1363 N/A INTRINSIC
low complexity region 1371 1384 N/A INTRINSIC
low complexity region 1432 1446 N/A INTRINSIC
low complexity region 1472 1488 N/A INTRINSIC
low complexity region 1493 1510 N/A INTRINSIC
low complexity region 1519 1530 N/A INTRINSIC
low complexity region 1569 1591 N/A INTRINSIC
low complexity region 1616 1655 N/A INTRINSIC
coiled coil region 1693 1723 N/A INTRINSIC
FN3 1805 1885 1.39e0 SMART
FN3 1901 2002 1.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114372
AA Change: S1398P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000110012
Gene: ENSMUSG00000031386
AA Change: S1398P

DomainStartEndE-ValueType
Pfam:Kelch_5 29 67 6.1e-7 PFAM
Pfam:Kelch_1 32 70 5e-8 PFAM
Pfam:Kelch_4 32 80 1.8e-7 PFAM
Pfam:Kelch_3 91 145 1.2e-8 PFAM
Pfam:Kelch_3 215 263 3.4e-9 PFAM
Pfam:Kelch_1 254 309 3.1e-7 PFAM
Pfam:Kelch_3 264 330 8.3e-8 PFAM
PDB:4GO6|C 360 402 1e-21 PDB
Blast:FN3 364 536 6e-61 BLAST
Blast:FN3 538 602 6e-6 BLAST
low complexity region 639 658 N/A INTRINSIC
Blast:FN3 740 932 1e-28 BLAST
low complexity region 933 950 N/A INTRINSIC
internal_repeat_2 975 1018 2.29e-5 PROSPERO
low complexity region 1019 1036 N/A INTRINSIC
internal_repeat_2 1040 1080 2.29e-5 PROSPERO
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1114 1130 N/A INTRINSIC
low complexity region 1135 1149 N/A INTRINSIC
low complexity region 1164 1182 N/A INTRINSIC
low complexity region 1235 1247 N/A INTRINSIC
low complexity region 1273 1282 N/A INTRINSIC
low complexity region 1308 1321 N/A INTRINSIC
low complexity region 1332 1346 N/A INTRINSIC
low complexity region 1349 1363 N/A INTRINSIC
low complexity region 1371 1384 N/A INTRINSIC
low complexity region 1432 1446 N/A INTRINSIC
low complexity region 1472 1488 N/A INTRINSIC
low complexity region 1563 1574 N/A INTRINSIC
low complexity region 1613 1635 N/A INTRINSIC
low complexity region 1660 1701 N/A INTRINSIC
coiled coil region 1738 1768 N/A INTRINSIC
FN3 1850 1930 1.39e0 SMART
FN3 1946 2047 1.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128136
SMART Domains Protein: ENSMUSP00000115792
Gene: ENSMUSG00000031386

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 38 54 N/A INTRINSIC
low complexity region 59 76 N/A INTRINSIC
low complexity region 85 96 N/A INTRINSIC
low complexity region 135 157 N/A INTRINSIC
low complexity region 182 223 N/A INTRINSIC
coiled coil region 259 289 N/A INTRINSIC
FN3 372 452 1.39e0 SMART
FN3 468 569 1.07e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131091
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156204
Meta Mutation Damage Score 0.0978 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: This gene encodes a transcription cofactor that regulates the progression of cell cycle and maintain the ability of embryonic stem cells to self-renew. The encoded protein is a large precursor that undergoes site-specific proteolytic cleavage to yield N- and C-terminal chains that form a non-covalent heterodimer. The encoded protein has been implicated in the regulation of expression of immediate early genes after herpes simplex virus infection and glucose-stimulated secretion of insulin by pancreatic beta cells. [provided by RefSeq, Aug 2015]
PHENOTYPE: Conditional loss of the maternally inherited allele is embryonic lethal with increased apoptosis and reduced cell proliferation. Liver-specific knockout leads to decreased liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,746,630 Y1445C probably damaging Het
Arhgef12 G A 9: 43,018,349 Q217* probably null Het
Bcas1 A G 2: 170,418,627 V44A probably benign Het
Clic4 A G 4: 135,226,039 V98A probably benign Het
Col6a3 A T 1: 90,807,614 I771N probably damaging Het
Creb3l1 T C 2: 91,993,319 I183V probably damaging Het
Dnhd1 T A 7: 105,693,954 W1502R probably damaging Het
Dync2h1 A T 9: 7,077,880 S2941T probably benign Het
Gm973 A G 1: 59,551,240 Y302C possibly damaging Het
Igsf10 T C 3: 59,318,750 I2501V probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Loxl4 T A 19: 42,607,591 Y141F probably benign Het
Man2a2 T A 7: 80,351,739 E1140V possibly damaging Het
Mgam A G 6: 40,763,085 D1664G probably benign Het
Mill2 A T 7: 18,856,531 T179S probably damaging Het
Ncf4 T C 15: 78,260,762 probably benign Het
Nol12 T C 15: 78,940,141 S154P probably damaging Het
Nupl1 A G 14: 60,247,426 S50P probably benign Het
Olfr106-ps T A 17: 37,395,486 N315K probably benign Het
Olfr736 T C 14: 50,393,446 I230T probably benign Het
Olfr849 A G 9: 19,440,999 T29A probably benign Het
Pdss1 T C 2: 22,915,505 I265T probably damaging Het
Piezo2 T C 18: 63,124,730 probably null Het
Rad50 T A 11: 53,702,005 N106I probably benign Het
Rhpn2 A G 7: 35,390,845 T631A probably benign Het
Rps11 T C 7: 45,122,944 M80V probably benign Het
Rrm1 T C 7: 102,447,824 Y104H probably benign Het
Sgsm3 T A 15: 81,010,301 probably benign Het
Slc9c1 A T 16: 45,544,791 L162F probably benign Het
Son A G 16: 91,658,411 T1349A possibly damaging Het
Stk24 A G 14: 121,292,082 L386S probably benign Het
Tfcp2 G T 15: 100,514,849 N307K possibly damaging Het
Trbv21 T A 6: 41,202,768 V6D probably benign Het
Trip11 A T 12: 101,893,768 D282E probably damaging Het
Ttn G T 2: 76,876,467 probably benign Het
Vmn2r38 A G 7: 9,097,563 probably null Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps8 T A 16: 21,495,914 L158Q probably damaging Het
Wdr66 T C 5: 123,293,810 I549T probably benign Het
Other mutations in Hcfc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Hcfc1 APN X 73949909 missense possibly damaging 0.92
IGL03191:Hcfc1 APN X 73955614 missense probably benign 0.30
IGL03198:Hcfc1 APN X 73951329 missense possibly damaging 0.69
R0242:Hcfc1 UTSW X 73948429 intron probably benign
R3618:Hcfc1 UTSW X 73950088 missense probably benign 0.14
R4785:Hcfc1 UTSW X 73965946 missense probably damaging 0.99
R6711:Hcfc1 UTSW X 73950065 missense probably damaging 0.99
X0021:Hcfc1 UTSW X 73952314 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACTTACCTTGGTTTGAGCTCATG -3'
(R):5'- TCAGCGAGTATGCTCCAACC -3'

Sequencing Primer
(F):5'- AGCTCATGTTAGAGGTGACAGTG -3'
(R):5'- GCCTTGTGAGACTCATGAGAC -3'
Posted On2015-06-20