Mutagenetix > Incidental Mutations

Incidental Mutation 'R4303:Dnah7c'

322479

Institutional Source

Beutler Lab

Gene Symbol

Dnah7c

Ensembl Gene

ENSMUSG00000101337

Gene Name

dynein, axonemal, heavy chain 7C

Synonyms

Dnahc7c

MMRRC Submission

041090-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.371) question?

Stock #

R4303 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46425592-46807476 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 46748578 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 3264 (Y3264H)

Ref Sequence

ENSEMBL: ENSMUSP00000140430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000189749]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000189749
AA Change: Y3264H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140430
Gene: ENSMUSG00000101337
AA Change: Y3264H

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	37	48	N/A	INTRINSIC
coiled coil region	714	746	N/A	INTRINSIC
Pfam:DHC_N2	754	1167	2.2e-138	PFAM
AAA	1320	1459	4e-3	SMART
Blast:AAA	1601	1829	4e-87	BLAST
AAA	1968	2116	8.7e-4	SMART
Pfam:AAA_8	2303	2574	6.2e-73	PFAM
Pfam:MT	2586	2935	5.4e-52	PFAM
Pfam:AAA_9	2953	3183	7.4e-63	PFAM
Pfam:Dynein_heavy	3312	4021	1.3e-250	PFAM

Meta Mutation Damage Score

0.1484

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 96.1%

Validation Efficiency

98% (44/45)

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb8	T	C	5: 24,401,057	S247P	probably damaging	Het
Atg4b	A	G	1: 93,768,262	E41G	probably benign	Het
Bckdk	T	C	7: 127,905,330		probably benign	Het
Cacna2d1	A	G	5: 16,302,248		probably null	Het
Chaf1a	A	G	17: 56,044,068	D16G	unknown	Het
Defb12	A	G	8: 19,112,721	I65T	probably benign	Het
Ehhadh	C	A	16: 21,762,852	K463N	probably damaging	Het
Ehmt2	G	A	17: 34,908,748	R901Q	possibly damaging	Het
Ern2	T	C	7: 122,177,846		probably null	Het
Esp6	A	G	17: 40,565,144	T28A	possibly damaging	Het
Fam189a2	G	A	19: 23,975,629	A439V	probably damaging	Het
Fam189a2	C	T	19: 23,975,638	S436N	probably damaging	Het
Gm17333	A	C	16: 77,852,879		noncoding transcript	Het
Heatr5a	T	C	12: 51,956,225	T165A	probably benign	Het
Hoxa5	T	C	6: 52,204,260	S31G	probably benign	Het
Ift80	A	G	3: 68,894,174	I744T	probably benign	Het
Kalrn	T	C	16: 34,235,391	K853E	probably damaging	Het
Krt36	A	T	11: 100,103,413	D279E	possibly damaging	Het
Map3k11	T	A	19: 5,690,824	V193E	probably damaging	Het
Mrgpra4	T	A	7: 47,980,936	M306L	probably benign	Het
Myo1a	A	G	10: 127,713,733	T428A	probably benign	Het
Nuggc	A	G	14: 65,611,172	H174R	possibly damaging	Het
Olfr293	G	A	7: 86,663,955	V98M	probably benign	Het
Olfr389	A	T	11: 73,776,838	M163K	possibly damaging	Het
Pigr	G	A	1: 130,841,817	D122N	probably benign	Het
Pik3ca	C	T	3: 32,439,935	R349*	probably null	Het
Rfxank	T	C	8: 70,136,212	D89G	probably damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGTGGCGGCGG	7: 97,579,920		probably benign	Het
Serpina1a	A	G	12: 103,854,675	L348P	probably damaging	Het
Shank1	A	G	7: 44,342,474	Y701C	unknown	Het
Six4	G	T	12: 73,112,540	D207E	possibly damaging	Het
Slco3a1	G	T	7: 74,554,528	D21E	probably benign	Het
Sox6	C	T	7: 115,544,469		probably null	Het
Spta1	A	G	1: 174,179,852	N216S	probably damaging	Het
Stard13	T	C	5: 151,062,869	N392S	possibly damaging	Het
Tax1bp1	T	C	6: 52,727,278	V81A	possibly damaging	Het
Trim29	G	T	9: 43,311,122	V83L	probably damaging	Het
Vmn1r90	C	T	7: 14,561,570	W201*	probably null	Het
Wdr31	T	A	4: 62,460,389	N7I	probably damaging	Het
Ypel4	A	G	2: 84,736,807		probably benign	Het
Zfp39	T	C	11: 58,890,017	K640E	probably damaging	Het
Zfp579	A	G	7: 4,993,073		probably benign	Het
Zfp974	C	A	7: 27,910,232	K689N	possibly damaging	Het

Other mutations in Dnah7c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00559:Dnah7c	APN	1	46807289	missense	possibly damaging	0.72
IGL02958:Dnah7c	APN	1	46657111	missense	probably damaging	1.00
IGL03035:Dnah7c	APN	1	46524117	missense	probably benign	0.37
IGL03161:Dnah7c	APN	1	46467296	missense	probably benign	0.20
IGL03178:Dnah7c	APN	1	46467365	missense	probably benign
IGL03052:Dnah7c	UTSW	1	46632149	missense	probably damaging	1.00
R0751:Dnah7c	UTSW	1	46465905	missense	probably benign
R1029:Dnah7c	UTSW	1	46612721	missense	probably damaging	1.00
R3104:Dnah7c	UTSW	1	46798279	missense	probably damaging	0.97
R3977:Dnah7c	UTSW	1	46628911	missense	possibly damaging	0.75
R4003:Dnah7c	UTSW	1	46681817	missense	probably damaging	1.00
R4133:Dnah7c	UTSW	1	46665990	missense	probably benign	0.01
R4329:Dnah7c	UTSW	1	46649281	missense	probably benign	0.33
R4434:Dnah7c	UTSW	1	46666282	missense	probably damaging	1.00
R4457:Dnah7c	UTSW	1	46740621	missense	probably damaging	1.00
R4470:Dnah7c	UTSW	1	46748635	missense	possibly damaging	0.56
R4507:Dnah7c	UTSW	1	46766611	missense	probably damaging	1.00
R4527:Dnah7c	UTSW	1	46532931	missense	probably benign	0.34
R4571:Dnah7c	UTSW	1	46533216	missense	probably damaging	0.99
R4589:Dnah7c	UTSW	1	46514583	nonsense	probably null
R4731:Dnah7c	UTSW	1	46770173	missense	probably damaging	1.00
R4732:Dnah7c	UTSW	1	46770173	missense	probably damaging	1.00
R4733:Dnah7c	UTSW	1	46770173	missense	probably damaging	1.00
R4747:Dnah7c	UTSW	1	46533168	missense	probably damaging	1.00
R4845:Dnah7c	UTSW	1	46793532	missense	probably damaging	1.00
R4873:Dnah7c	UTSW	1	46688925	missense	probably benign
R4875:Dnah7c	UTSW	1	46688925	missense	probably benign
R4916:Dnah7c	UTSW	1	46595008	missense	probably damaging	1.00
R5241:Dnah7c	UTSW	1	46530500	missense	probably benign
R5279:Dnah7c	UTSW	1	46519269	missense	probably benign	0.14
R5327:Dnah7c	UTSW	1	46665568	missense	probably benign	0.05
R5546:Dnah7c	UTSW	1	46666317	missense	probably damaging	1.00
R5605:Dnah7c	UTSW	1	46798235	missense	possibly damaging	0.84
R5637:Dnah7c	UTSW	1	46760361	splice site	probably null
R5639:Dnah7c	UTSW	1	46739668	missense	probably benign
R5663:Dnah7c	UTSW	1	46535148	missense	probably damaging	1.00
R5718:Dnah7c	UTSW	1	46748666	missense	possibly damaging	0.47
R5759:Dnah7c	UTSW	1	46615367	missense	probably damaging	1.00
R5771:Dnah7c	UTSW	1	46639665	missense	probably benign	0.00
R5784:Dnah7c	UTSW	1	46524068	missense	possibly damaging	0.80
R5800:Dnah7c	UTSW	1	46647015	missense	probably benign	0.01
R5933:Dnah7c	UTSW	1	46519215	missense	probably damaging	1.00
R5948:Dnah7c	UTSW	1	46672497	missense	probably benign	0.21
R6034:Dnah7c	UTSW	1	46457258	missense	probably benign	0.00
R6034:Dnah7c	UTSW	1	46457258	missense	probably benign	0.00
R6487:Dnah7c	UTSW	1	46769124	missense	probably damaging	1.00
R6536:Dnah7c	UTSW	1	46658290	missense	probably benign	0.00
R6614:Dnah7c	UTSW	1	46649340	missense	probably benign
R6614:Dnah7c	UTSW	1	46649351	missense	probably benign
R6615:Dnah7c	UTSW	1	46515439	missense	probably benign	0.01
R6615:Dnah7c	UTSW	1	46649340	missense	probably benign
R6615:Dnah7c	UTSW	1	46649351	missense	probably benign
R6649:Dnah7c	UTSW	1	46649340	missense	probably benign
R6649:Dnah7c	UTSW	1	46649351	missense	probably benign
R6650:Dnah7c	UTSW	1	46649340	missense	probably benign
R6650:Dnah7c	UTSW	1	46649351	missense	probably benign
R6651:Dnah7c	UTSW	1	46649340	missense	probably benign
R6651:Dnah7c	UTSW	1	46649351	missense	probably benign
R6653:Dnah7c	UTSW	1	46649340	missense	probably benign
R6653:Dnah7c	UTSW	1	46649351	missense	probably benign
R6714:Dnah7c	UTSW	1	46740806	missense	probably damaging	0.99
R6729:Dnah7c	UTSW	1	46672521	missense	possibly damaging	0.46
R6760:Dnah7c	UTSW	1	46649340	missense	probably benign
R6760:Dnah7c	UTSW	1	46649351	missense	probably benign
R6763:Dnah7c	UTSW	1	46628890	missense	possibly damaging	0.60
R6866:Dnah7c	UTSW	1	46657243	missense	probably damaging	1.00
R6880:Dnah7c	UTSW	1	46527671	missense	probably damaging	0.97
R6988:Dnah7c	UTSW	1	46666213	missense	possibly damaging	0.68
R6995:Dnah7c	UTSW	1	46455813	missense	probably benign	0.07
R7007:Dnah7c	UTSW	1	46532750	missense	probably benign	0.04
R7086:Dnah7c	UTSW	1	46750125	missense	probably benign	0.00
R7128:Dnah7c	UTSW	1	46527485	missense	probably benign
R7131:Dnah7c	UTSW	1	46681772	missense	probably benign	0.00
R7135:Dnah7c	UTSW	1	46533208	missense	probably damaging	1.00
R7171:Dnah7c	UTSW	1	46680738	missense	probably damaging	0.99
R7176:Dnah7c	UTSW	1	46430809	missense	probably benign	0.00
R7221:Dnah7c	UTSW	1	46455777	missense	possibly damaging	0.87
R7310:Dnah7c	UTSW	1	46596967	missense	possibly damaging	0.94
R7319:Dnah7c	UTSW	1	46780775	missense	probably benign	0.31
R7319:Dnah7c	UTSW	1	46784448	missense	possibly damaging	0.95
R7404:Dnah7c	UTSW	1	46666063	missense	possibly damaging	0.52
R7452:Dnah7c	UTSW	1	46647036	missense	possibly damaging	0.91
R7515:Dnah7c	UTSW	1	46457290	missense	probably benign
R7534:Dnah7c	UTSW	1	46770067	missense	probably damaging	0.98
R7542:Dnah7c	UTSW	1	46784498	missense	probably benign	0.00
R7605:Dnah7c	UTSW	1	46632310	missense	probably damaging	1.00
R7643:Dnah7c	UTSW	1	46602813	missense	probably benign
R7770:Dnah7c	UTSW	1	46626300	splice site	probably null
R7884:Dnah7c	UTSW	1	46791769	missense	probably benign	0.23
R7899:Dnah7c	UTSW	1	46514701	missense	probably benign	0.00
R8025:Dnah7c	UTSW	1	46457296	missense	probably benign	0.01
R8057:Dnah7c	UTSW	1	46688952	missense	possibly damaging	0.52
R8191:Dnah7c	UTSW	1	46607458	missense	possibly damaging	0.56
R8255:Dnah7c	UTSW	1	46659429	missense	probably damaging	1.00
R8428:Dnah7c	UTSW	1	46672376	missense	probably damaging	1.00
R8441:Dnah7c	UTSW	1	46533238	missense	probably damaging	1.00
R8485:Dnah7c	UTSW	1	46680792	missense	probably benign	0.05
R8559:Dnah7c	UTSW	1	46725139	missense	probably damaging	1.00
R8752:Dnah7c	UTSW	1	46672541	missense	probably benign	0.00
R8869:Dnah7c	UTSW	1	46632344	missense	probably damaging	0.97
R9058:Dnah7c	UTSW	1	46766656	missense	probably damaging	0.97
R9121:Dnah7c	UTSW	1	46665490	missense	probably damaging	0.97
R9121:Dnah7c	UTSW	1	46777736	missense	probably benign	0.00
R9246:Dnah7c	UTSW	1	46532774	missense	possibly damaging	0.51
R9319:Dnah7c	UTSW	1	46482008	missense	possibly damaging	0.94
R9388:Dnah7c	UTSW	1	46740726	missense	probably damaging	1.00
Z1176:Dnah7c	UTSW	1	46467302	missense	probably benign	0.00
Z1176:Dnah7c	UTSW	1	46615281	missense	probably damaging	1.00
Z1176:Dnah7c	UTSW	1	46639665	missense	probably benign
Z1176:Dnah7c	UTSW	1	46646992	critical splice acceptor site	probably null
Z1176:Dnah7c	UTSW	1	46760316	missense	possibly damaging	0.95
Z1177:Dnah7c	UTSW	1	46654103	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- CTAGCTCTCAAACTGGCAACTC -3'
(R):5'- TCTAGACACGGAGAATCTTTGAC -3'

Sequencing Primer
(F):5'- GCAACTCAAGGAGTAAAGATCTTTG -3'
(R):5'- CACGGAGAATCTTTGACACTGG -3'

Posted On

2015-06-20