Incidental Mutation 'R4303:Pigr'
ID322481
Institutional Source Beutler Lab
Gene Symbol Pigr
Ensembl Gene ENSMUSG00000026417
Gene Namepolymeric immunoglobulin receptor
Synonyms
MMRRC Submission 041090-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R4303 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location130826684-130852249 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 130841817 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 122 (D122N)
Ref Sequence ENSEMBL: ENSMUSP00000121686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027675] [ENSMUST00000133792] [ENSMUST00000137782]
Predicted Effect probably benign
Transcript: ENSMUST00000027675
AA Change: D122N

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000027675
Gene: ENSMUSG00000026417
AA Change: D122N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 25 128 1.6e-8 SMART
IG 137 238 8.1e-8 SMART
IG 242 346 1.4e-3 SMART
IG 355 457 3.1e-5 SMART
IG 469 563 1e-10 SMART
IG_like 483 548 8e-3 SMART
low complexity region 627 644 N/A INTRINSIC
transmembrane domain 646 668 N/A INTRINSIC
low complexity region 730 746 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133792
AA Change: D122N

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000121686
Gene: ENSMUSG00000026417
AA Change: D122N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 25 128 1.6e-8 SMART
Blast:IG 137 210 3e-47 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000137782
AA Change: D122N

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114334
Gene: ENSMUSG00000026417
AA Change: D122N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 25 128 3.91e-6 SMART
Blast:IG 137 201 4e-40 BLAST
Meta Mutation Damage Score 0.3843 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the immunoglobulin superfamily. The encoded poly-Ig receptor binds polymeric immunoglobulin molecules at the basolateral surface of epithelial cells; the complex is then transported across the cell to be secreted at the apical surface. A significant association was found between immunoglobulin A nephropathy and several SNPs in this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Nullizygous mice show impaired transepithelial transport of dimeric IgA, increased serum IgA levels and mucosal leakiness. Studies of one null allele show increased susceptibility to mycobacterial infections while another allele causes impaired clearanceof the protozoan parasite Giardia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,401,057 S247P probably damaging Het
Atg4b A G 1: 93,768,262 E41G probably benign Het
Bckdk T C 7: 127,905,330 probably benign Het
Cacna2d1 A G 5: 16,302,248 probably null Het
Chaf1a A G 17: 56,044,068 D16G unknown Het
Defb12 A G 8: 19,112,721 I65T probably benign Het
Dnah7c T C 1: 46,748,578 Y3264H probably damaging Het
Ehhadh C A 16: 21,762,852 K463N probably damaging Het
Ehmt2 G A 17: 34,908,748 R901Q possibly damaging Het
Ern2 T C 7: 122,177,846 probably null Het
Esp6 A G 17: 40,565,144 T28A possibly damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Gm17333 A C 16: 77,852,879 noncoding transcript Het
Heatr5a T C 12: 51,956,225 T165A probably benign Het
Hoxa5 T C 6: 52,204,260 S31G probably benign Het
Ift80 A G 3: 68,894,174 I744T probably benign Het
Kalrn T C 16: 34,235,391 K853E probably damaging Het
Krt36 A T 11: 100,103,413 D279E possibly damaging Het
Map3k11 T A 19: 5,690,824 V193E probably damaging Het
Mrgpra4 T A 7: 47,980,936 M306L probably benign Het
Myo1a A G 10: 127,713,733 T428A probably benign Het
Nuggc A G 14: 65,611,172 H174R possibly damaging Het
Olfr293 G A 7: 86,663,955 V98M probably benign Het
Olfr389 A T 11: 73,776,838 M163K possibly damaging Het
Pik3ca C T 3: 32,439,935 R349* probably null Het
Rfxank T C 8: 70,136,212 D89G probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGTGGCGGCGG 7: 97,579,920 probably benign Het
Serpina1a A G 12: 103,854,675 L348P probably damaging Het
Shank1 A G 7: 44,342,474 Y701C unknown Het
Six4 G T 12: 73,112,540 D207E possibly damaging Het
Slco3a1 G T 7: 74,554,528 D21E probably benign Het
Sox6 C T 7: 115,544,469 probably null Het
Spta1 A G 1: 174,179,852 N216S probably damaging Het
Stard13 T C 5: 151,062,869 N392S possibly damaging Het
Tax1bp1 T C 6: 52,727,278 V81A possibly damaging Het
Trim29 G T 9: 43,311,122 V83L probably damaging Het
Vmn1r90 C T 7: 14,561,570 W201* probably null Het
Wdr31 T A 4: 62,460,389 N7I probably damaging Het
Ypel4 A G 2: 84,736,807 probably benign Het
Zfp39 T C 11: 58,890,017 K640E probably damaging Het
Zfp579 A G 7: 4,993,073 probably benign Het
Zfp974 C A 7: 27,910,232 K689N possibly damaging Het
Other mutations in Pigr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Pigr APN 1 130834430 start codon destroyed probably null 1.00
IGL01565:Pigr APN 1 130844474 missense possibly damaging 0.93
IGL01592:Pigr APN 1 130849058 missense probably damaging 1.00
IGL02153:Pigr APN 1 130849056 splice site probably null
IGL02508:Pigr APN 1 130850858 missense probably benign 0.02
IGL02815:Pigr APN 1 130841821 missense probably damaging 1.00
R0834:Pigr UTSW 1 130844544 nonsense probably null
R1453:Pigr UTSW 1 130841544 missense probably benign 0.00
R1728:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1729:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1730:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1736:Pigr UTSW 1 130841803 missense possibly damaging 0.92
R1739:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1742:Pigr UTSW 1 130845086 missense probably damaging 1.00
R1762:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1783:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1784:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1785:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1929:Pigr UTSW 1 130846662 unclassified probably benign
R2065:Pigr UTSW 1 130850880 missense probably benign 0.20
R2275:Pigr UTSW 1 130846470 missense probably benign 0.00
R2513:Pigr UTSW 1 130846620 missense possibly damaging 0.71
R2910:Pigr UTSW 1 130849533 missense probably damaging 1.00
R2911:Pigr UTSW 1 130849533 missense probably damaging 1.00
R2964:Pigr UTSW 1 130841535 missense probably damaging 1.00
R3857:Pigr UTSW 1 130847261 missense probably benign 0.06
R4165:Pigr UTSW 1 130841817 missense probably benign 0.26
R4166:Pigr UTSW 1 130841817 missense probably benign 0.26
R4735:Pigr UTSW 1 130846554 missense probably damaging 0.99
R4909:Pigr UTSW 1 130848458 missense possibly damaging 0.77
R4993:Pigr UTSW 1 130841817 missense probably benign 0.26
R4994:Pigr UTSW 1 130841817 missense probably benign 0.26
R5033:Pigr UTSW 1 130844699 missense probably damaging 1.00
R5116:Pigr UTSW 1 130849031 missense probably benign 0.00
R5304:Pigr UTSW 1 130849493 missense probably benign 0.00
R5440:Pigr UTSW 1 130849622 splice site probably null
R5853:Pigr UTSW 1 130846604 nonsense probably null
R5934:Pigr UTSW 1 130844527 missense probably damaging 0.98
R6015:Pigr UTSW 1 130847261 missense probably benign 0.06
R6291:Pigr UTSW 1 130841761 missense probably benign 0.06
R6749:Pigr UTSW 1 130846548 missense probably benign 0.14
R6941:Pigr UTSW 1 130847327 missense probably damaging 1.00
R7369:Pigr UTSW 1 130841766 missense probably benign 0.00
R7391:Pigr UTSW 1 130849566 missense probably damaging 1.00
R7564:Pigr UTSW 1 130841666 missense possibly damaging 0.67
R7760:Pigr UTSW 1 130846631 missense possibly damaging 0.59
R7995:Pigr UTSW 1 130841686 missense probably damaging 1.00
R8094:Pigr UTSW 1 130846510 missense probably damaging 1.00
R8096:Pigr UTSW 1 130846510 missense probably damaging 1.00
Z1176:Pigr UTSW 1 130850815 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- AACGCTCATCTCTTCAAATGGC -3'
(R):5'- ACATGGTAAGTCTCACCCATTCC -3'

Sequencing Primer
(F):5'- TTCAAATGGCTACCTCTCCAAG -3'
(R):5'- CTATTGTGGAAAGTCTTTGCCTCAG -3'
Posted On2015-06-20