Incidental Mutation 'R4303:Ift80'
ID322485
Institutional Source Beutler Lab
Gene Symbol Ift80
Ensembl Gene ENSMUSG00000027778
Gene Nameintraflagellar transport 80
Synonyms4921524P20Rik, Wdr56
MMRRC Submission 041090-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R4303 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location68892499-69004570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 68894174 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 744 (I744T)
Ref Sequence ENSEMBL: ENSMUSP00000133263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029347] [ENSMUST00000107812] [ENSMUST00000169064]
Predicted Effect probably benign
Transcript: ENSMUST00000029347
AA Change: I744T

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000029347
Gene: ENSMUSG00000027778
AA Change: I744T

DomainStartEndE-ValueType
WD40 4 41 1.43e0 SMART
Blast:WD40 46 93 4e-9 BLAST
WD40 95 134 9.38e-5 SMART
WD40 136 176 2.75e1 SMART
WD40 177 216 1.42e-4 SMART
WD40 219 256 1.56e-1 SMART
WD40 258 297 2.75e1 SMART
low complexity region 429 440 N/A INTRINSIC
Blast:WD40 496 533 4e-18 BLAST
low complexity region 764 772 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107812
AA Change: I744T

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000103442
Gene: ENSMUSG00000027778
AA Change: I744T

DomainStartEndE-ValueType
WD40 4 41 1.43e0 SMART
Blast:WD40 46 93 4e-9 BLAST
WD40 95 134 9.38e-5 SMART
WD40 136 176 2.75e1 SMART
WD40 177 216 1.42e-4 SMART
WD40 219 256 1.56e-1 SMART
WD40 258 297 2.75e1 SMART
low complexity region 429 440 N/A INTRINSIC
Blast:WD40 496 533 4e-18 BLAST
low complexity region 764 772 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136176
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136448
Predicted Effect probably benign
Transcript: ENSMUST00000169064
AA Change: I744T

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133263
Gene: ENSMUSG00000027778
AA Change: I744T

DomainStartEndE-ValueType
WD40 4 41 1.43e0 SMART
Blast:WD40 46 93 4e-9 BLAST
WD40 95 134 9.38e-5 SMART
WD40 136 176 2.75e1 SMART
WD40 177 216 1.42e-4 SMART
WD40 219 256 1.56e-1 SMART
WD40 258 297 2.75e1 SMART
low complexity region 429 440 N/A INTRINSIC
Blast:WD40 496 533 4e-18 BLAST
low complexity region 764 772 N/A INTRINSIC
Meta Mutation Damage Score 0.0690 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the intraflagellar transport complex B and is necessary for the function of motile and sensory cilia. Defects in this gene are a cause of asphyxiating thoracic dystrophy 2 (ATD2). Three transcript variants encoding two different isoforms have been found for this gene.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele exhibit partial perinatal lethality, decreased body size, postnatal growth retardation, shortened long bones, constricted thoracic cage, periaxial polydactyly, and small cranium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,401,057 S247P probably damaging Het
Atg4b A G 1: 93,768,262 E41G probably benign Het
Bckdk T C 7: 127,905,330 probably benign Het
Cacna2d1 A G 5: 16,302,248 probably null Het
Chaf1a A G 17: 56,044,068 D16G unknown Het
Defb12 A G 8: 19,112,721 I65T probably benign Het
Dnah7c T C 1: 46,748,578 Y3264H probably damaging Het
Ehhadh C A 16: 21,762,852 K463N probably damaging Het
Ehmt2 G A 17: 34,908,748 R901Q possibly damaging Het
Ern2 T C 7: 122,177,846 probably null Het
Esp6 A G 17: 40,565,144 T28A possibly damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Gm17333 A C 16: 77,852,879 noncoding transcript Het
Heatr5a T C 12: 51,956,225 T165A probably benign Het
Hoxa5 T C 6: 52,204,260 S31G probably benign Het
Kalrn T C 16: 34,235,391 K853E probably damaging Het
Krt36 A T 11: 100,103,413 D279E possibly damaging Het
Map3k11 T A 19: 5,690,824 V193E probably damaging Het
Mrgpra4 T A 7: 47,980,936 M306L probably benign Het
Myo1a A G 10: 127,713,733 T428A probably benign Het
Nuggc A G 14: 65,611,172 H174R possibly damaging Het
Olfr293 G A 7: 86,663,955 V98M probably benign Het
Olfr389 A T 11: 73,776,838 M163K possibly damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Pik3ca C T 3: 32,439,935 R349* probably null Het
Rfxank T C 8: 70,136,212 D89G probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGTGGCGGCGG 7: 97,579,920 probably benign Het
Serpina1a A G 12: 103,854,675 L348P probably damaging Het
Shank1 A G 7: 44,342,474 Y701C unknown Het
Six4 G T 12: 73,112,540 D207E possibly damaging Het
Slco3a1 G T 7: 74,554,528 D21E probably benign Het
Sox6 C T 7: 115,544,469 probably null Het
Spta1 A G 1: 174,179,852 N216S probably damaging Het
Stard13 T C 5: 151,062,869 N392S possibly damaging Het
Tax1bp1 T C 6: 52,727,278 V81A possibly damaging Het
Trim29 G T 9: 43,311,122 V83L probably damaging Het
Vmn1r90 C T 7: 14,561,570 W201* probably null Het
Wdr31 T A 4: 62,460,389 N7I probably damaging Het
Ypel4 A G 2: 84,736,807 probably benign Het
Zfp39 T C 11: 58,890,017 K640E probably damaging Het
Zfp579 A G 7: 4,993,073 probably benign Het
Zfp974 C A 7: 27,910,232 K689N possibly damaging Het
Other mutations in Ift80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Ift80 APN 3 68914653 nonsense probably null
IGL01020:Ift80 APN 3 68963679 missense probably damaging 1.00
IGL01544:Ift80 APN 3 68990782 missense probably benign 0.05
IGL01612:Ift80 APN 3 68963663 missense possibly damaging 0.61
IGL01743:Ift80 APN 3 68962296 missense probably benign 0.00
IGL02187:Ift80 APN 3 68985456 missense probably damaging 1.00
IGL02381:Ift80 APN 3 68962320 splice site probably null
IGL02407:Ift80 APN 3 68898536 missense probably benign
IGL02510:Ift80 APN 3 68898543 missense probably benign 0.07
IGL02512:Ift80 APN 3 68927725 critical splice donor site probably null
R0091:Ift80 UTSW 3 68914675 missense probably damaging 1.00
R0212:Ift80 UTSW 3 68940173 missense probably benign 0.05
R0348:Ift80 UTSW 3 68935899 missense probably benign
R0357:Ift80 UTSW 3 68914653 nonsense probably null
R1381:Ift80 UTSW 3 68914783 missense possibly damaging 0.78
R1419:Ift80 UTSW 3 68940198 missense probably damaging 1.00
R1643:Ift80 UTSW 3 68916157 missense probably benign 0.06
R1899:Ift80 UTSW 3 68918513 missense probably benign 0.00
R1926:Ift80 UTSW 3 68916165 missense probably damaging 1.00
R2013:Ift80 UTSW 3 68990784 missense possibly damaging 0.62
R3894:Ift80 UTSW 3 68917999 missense probably damaging 1.00
R4214:Ift80 UTSW 3 68990808 missense possibly damaging 0.64
R4290:Ift80 UTSW 3 68963690 missense probably damaging 0.96
R4361:Ift80 UTSW 3 68963649 missense probably damaging 1.00
R4576:Ift80 UTSW 3 68950530 missense possibly damaging 0.71
R4596:Ift80 UTSW 3 68990759 missense probably benign 0.01
R4652:Ift80 UTSW 3 68914940 missense probably benign 0.32
R4654:Ift80 UTSW 3 68918537 missense possibly damaging 0.94
R4720:Ift80 UTSW 3 68962290 missense possibly damaging 0.50
R4865:Ift80 UTSW 3 68990759 missense probably benign 0.01
R4885:Ift80 UTSW 3 68950496 missense probably damaging 0.98
R5357:Ift80 UTSW 3 68990780 missense possibly damaging 0.62
R5561:Ift80 UTSW 3 68967863 missense probably benign 0.00
R5589:Ift80 UTSW 3 68930900 missense probably damaging 1.00
R5806:Ift80 UTSW 3 68950476 missense probably benign 0.09
R6910:Ift80 UTSW 3 68927735 missense probably benign 0.01
R6962:Ift80 UTSW 3 68994545 start gained probably benign
R7157:Ift80 UTSW 3 68990944 nonsense probably null
R7452:Ift80 UTSW 3 68994282 splice site probably null
R7504:Ift80 UTSW 3 68918005 missense probably damaging 0.99
R8077:Ift80 UTSW 3 68916145 missense probably benign 0.01
R8435:Ift80 UTSW 3 68985454 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTAACCTTTCTGAACGTACC -3'
(R):5'- TCAAAGGTAGCTCATAGGGTTTC -3'

Sequencing Primer
(F):5'- CTCATGTATGCTAGGCAAGTGCAC -3'
(R):5'- AGCTCATAGGGTTTCAGCGTTAC -3'
Posted On2015-06-20