Incidental Mutation 'R4303:Abcb8'
ID322488
Institutional Source Beutler Lab
Gene Symbol Abcb8
Ensembl Gene ENSMUSG00000028973
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 8
Synonyms
MMRRC Submission 041090-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R4303 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location24393663-24410054 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24401057 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 247 (S247P)
Ref Sequence ENSEMBL: ENSMUSP00000110729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073076] [ENSMUST00000115077] [ENSMUST00000138168]
Predicted Effect probably damaging
Transcript: ENSMUST00000073076
AA Change: S247P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072826
Gene: ENSMUSG00000028973
AA Change: S247P

DomainStartEndE-ValueType
low complexity region 29 44 N/A INTRINSIC
Pfam:ABC_membrane 130 407 3.6e-48 PFAM
AAA 481 668 8.58e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115074
SMART Domains Protein: ENSMUSP00000110726
Gene: ENSMUSG00000028973

DomainStartEndE-ValueType
low complexity region 29 44 N/A INTRINSIC
Pfam:ABC_membrane 130 407 2.7e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115077
AA Change: S247P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110729
Gene: ENSMUSG00000028973
AA Change: S247P

DomainStartEndE-ValueType
low complexity region 29 44 N/A INTRINSIC
Pfam:ABC_membrane 130 407 1.1e-56 PFAM
AAA 481 668 8.58e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136459
Predicted Effect probably benign
Transcript: ENSMUST00000138168
SMART Domains Protein: ENSMUSP00000119791
Gene: ENSMUSG00000028973

DomainStartEndE-ValueType
low complexity region 29 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198166
Meta Mutation Damage Score 0.9497 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This nuclear gene encodes a multi-pass membrane protein that is targeted to the mitochondrial inner membrane. The encoded protein is an ATP-dependent transporter that may mediate the passage of organic and inorganic molecules out of the mitochondria. Loss of function of the related gene in mouse results in a disruption of iron homeostasis between the mitochondria and cytosol. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Inducible cardiac specific deletion results in mild cardiomyopathy, mitochondrial defects and elevated heart mitochondrial iron levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg4b A G 1: 93,768,262 E41G probably benign Het
Bckdk T C 7: 127,905,330 probably benign Het
Cacna2d1 A G 5: 16,302,248 probably null Het
Chaf1a A G 17: 56,044,068 D16G unknown Het
Defb12 A G 8: 19,112,721 I65T probably benign Het
Dnah7c T C 1: 46,748,578 Y3264H probably damaging Het
Ehhadh C A 16: 21,762,852 K463N probably damaging Het
Ehmt2 G A 17: 34,908,748 R901Q possibly damaging Het
Ern2 T C 7: 122,177,846 probably null Het
Esp6 A G 17: 40,565,144 T28A possibly damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Gm17333 A C 16: 77,852,879 noncoding transcript Het
Heatr5a T C 12: 51,956,225 T165A probably benign Het
Hoxa5 T C 6: 52,204,260 S31G probably benign Het
Ift80 A G 3: 68,894,174 I744T probably benign Het
Kalrn T C 16: 34,235,391 K853E probably damaging Het
Krt36 A T 11: 100,103,413 D279E possibly damaging Het
Map3k11 T A 19: 5,690,824 V193E probably damaging Het
Mrgpra4 T A 7: 47,980,936 M306L probably benign Het
Myo1a A G 10: 127,713,733 T428A probably benign Het
Nuggc A G 14: 65,611,172 H174R possibly damaging Het
Olfr293 G A 7: 86,663,955 V98M probably benign Het
Olfr389 A T 11: 73,776,838 M163K possibly damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Pik3ca C T 3: 32,439,935 R349* probably null Het
Rfxank T C 8: 70,136,212 D89G probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGTGGCGGCGG 7: 97,579,920 probably benign Het
Serpina1a A G 12: 103,854,675 L348P probably damaging Het
Shank1 A G 7: 44,342,474 Y701C unknown Het
Six4 G T 12: 73,112,540 D207E possibly damaging Het
Slco3a1 G T 7: 74,554,528 D21E probably benign Het
Sox6 C T 7: 115,544,469 probably null Het
Spta1 A G 1: 174,179,852 N216S probably damaging Het
Stard13 T C 5: 151,062,869 N392S possibly damaging Het
Tax1bp1 T C 6: 52,727,278 V81A possibly damaging Het
Trim29 G T 9: 43,311,122 V83L probably damaging Het
Vmn1r90 C T 7: 14,561,570 W201* probably null Het
Wdr31 T A 4: 62,460,389 N7I probably damaging Het
Ypel4 A G 2: 84,736,807 probably benign Het
Zfp39 T C 11: 58,890,017 K640E probably damaging Het
Zfp579 A G 7: 4,993,073 probably benign Het
Zfp974 C A 7: 27,910,232 K689N possibly damaging Het
Other mutations in Abcb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02349:Abcb8 APN 5 24406464 missense probably benign
IGL02819:Abcb8 APN 5 24406424 missense probably benign
Thumbs UTSW 5 24402103 missense probably damaging 0.99
R0320:Abcb8 UTSW 5 24400790 missense probably damaging 1.00
R0458:Abcb8 UTSW 5 24406233 missense probably benign 0.02
R0927:Abcb8 UTSW 5 24402319 missense probably damaging 1.00
R1120:Abcb8 UTSW 5 24408820 critical splice donor site probably null
R1553:Abcb8 UTSW 5 24408750 missense probably damaging 1.00
R3738:Abcb8 UTSW 5 24400621 missense probably benign 0.00
R3739:Abcb8 UTSW 5 24400621 missense probably benign 0.00
R4035:Abcb8 UTSW 5 24400621 missense probably benign 0.00
R4930:Abcb8 UTSW 5 24400781 missense possibly damaging 0.89
R5369:Abcb8 UTSW 5 24400139 missense possibly damaging 0.75
R5370:Abcb8 UTSW 5 24400139 missense possibly damaging 0.75
R5485:Abcb8 UTSW 5 24400161 missense probably benign 0.01
R5505:Abcb8 UTSW 5 24401038 missense probably damaging 1.00
R5627:Abcb8 UTSW 5 24400139 missense possibly damaging 0.75
R5633:Abcb8 UTSW 5 24403109 missense probably damaging 1.00
R5693:Abcb8 UTSW 5 24400139 missense possibly damaging 0.75
R5761:Abcb8 UTSW 5 24405881 intron probably benign
R5866:Abcb8 UTSW 5 24402103 missense probably damaging 0.99
R5995:Abcb8 UTSW 5 24400139 missense possibly damaging 0.75
R5996:Abcb8 UTSW 5 24400139 missense possibly damaging 0.75
R6621:Abcb8 UTSW 5 24394510 missense probably benign
R7407:Abcb8 UTSW 5 24400676 missense probably benign 0.00
R8026:Abcb8 UTSW 5 24406725 missense probably damaging 1.00
R8220:Abcb8 UTSW 5 24406785 missense possibly damaging 0.70
X0026:Abcb8 UTSW 5 24401046 missense possibly damaging 0.95
Z1176:Abcb8 UTSW 5 24400995 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACTAGCAGCTGTAGTGGG -3'
(R):5'- GCAAGGTTTCAGAGCATGGG -3'

Sequencing Primer
(F):5'- CAGCTGTAGTGGGTGGGACC -3'
(R):5'- AGCAGCCTGTCCTGACTCTTTAG -3'
Posted On2015-06-20