Incidental Mutation 'R4303:Hoxa5'
ID322490
Institutional Source Beutler Lab
Gene Symbol Hoxa5
Ensembl Gene ENSMUSG00000038253
Gene Namehomeobox A5
SynonymsHox-1.3
MMRRC Submission 041090-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.700) question?
Stock #R4303 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location52201754-52204587 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52204260 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 31 (S31G)
Ref Sequence ENSEMBL: ENSMUSP00000039012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048794] [ENSMUST00000062829] [ENSMUST00000114434] [ENSMUST00000128102]
Predicted Effect probably benign
Transcript: ENSMUST00000048794
AA Change: S31G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000039012
Gene: ENSMUSG00000038253
AA Change: S31G

DomainStartEndE-ValueType
low complexity region 65 86 N/A INTRINSIC
low complexity region 117 134 N/A INTRINSIC
low complexity region 146 175 N/A INTRINSIC
HOX 195 257 1.63e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062829
SMART Domains Protein: ENSMUSP00000058755
Gene: ENSMUSG00000043219

DomainStartEndE-ValueType
HOX 154 216 2.43e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114434
SMART Domains Protein: ENSMUSP00000110077
Gene: ENSMUSG00000079560

DomainStartEndE-ValueType
low complexity region 76 131 N/A INTRINSIC
HOX 192 254 3.35e-28 SMART
low complexity region 287 302 N/A INTRINSIC
low complexity region 304 326 N/A INTRINSIC
Pfam:DUF4074 377 441 9e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142764
Meta Mutation Damage Score 0.0586 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. Methylation of this gene may result in the loss of its expression and, since the encoded protein upregulates the tumor suppressor p53, this protein may play an important role in tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice show skeletal defects, tracheal and lung dysmorphology, reduced surfactant production, emphysema, and partial neonatal lethality. Survivors show stunted growth, delayed ear elevation and eyelid opening, and altered thyroid development, digestive secretion, and ovarian biology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,401,057 S247P probably damaging Het
Atg4b A G 1: 93,768,262 E41G probably benign Het
Bckdk T C 7: 127,905,330 probably benign Het
Cacna2d1 A G 5: 16,302,248 probably null Het
Chaf1a A G 17: 56,044,068 D16G unknown Het
Defb12 A G 8: 19,112,721 I65T probably benign Het
Dnah7c T C 1: 46,748,578 Y3264H probably damaging Het
Ehhadh C A 16: 21,762,852 K463N probably damaging Het
Ehmt2 G A 17: 34,908,748 R901Q possibly damaging Het
Ern2 T C 7: 122,177,846 probably null Het
Esp6 A G 17: 40,565,144 T28A possibly damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Gm17333 A C 16: 77,852,879 noncoding transcript Het
Heatr5a T C 12: 51,956,225 T165A probably benign Het
Ift80 A G 3: 68,894,174 I744T probably benign Het
Kalrn T C 16: 34,235,391 K853E probably damaging Het
Krt36 A T 11: 100,103,413 D279E possibly damaging Het
Map3k11 T A 19: 5,690,824 V193E probably damaging Het
Mrgpra4 T A 7: 47,980,936 M306L probably benign Het
Myo1a A G 10: 127,713,733 T428A probably benign Het
Nuggc A G 14: 65,611,172 H174R possibly damaging Het
Olfr293 G A 7: 86,663,955 V98M probably benign Het
Olfr389 A T 11: 73,776,838 M163K possibly damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Pik3ca C T 3: 32,439,935 R349* probably null Het
Rfxank T C 8: 70,136,212 D89G probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGTGGCGGCGG 7: 97,579,920 probably benign Het
Serpina1a A G 12: 103,854,675 L348P probably damaging Het
Shank1 A G 7: 44,342,474 Y701C unknown Het
Six4 G T 12: 73,112,540 D207E possibly damaging Het
Slco3a1 G T 7: 74,554,528 D21E probably benign Het
Sox6 C T 7: 115,544,469 probably null Het
Spta1 A G 1: 174,179,852 N216S probably damaging Het
Stard13 T C 5: 151,062,869 N392S possibly damaging Het
Tax1bp1 T C 6: 52,727,278 V81A possibly damaging Het
Trim29 G T 9: 43,311,122 V83L probably damaging Het
Vmn1r90 C T 7: 14,561,570 W201* probably null Het
Wdr31 T A 4: 62,460,389 N7I probably damaging Het
Ypel4 A G 2: 84,736,807 probably benign Het
Zfp39 T C 11: 58,890,017 K640E probably damaging Het
Zfp579 A G 7: 4,993,073 probably benign Het
Zfp974 C A 7: 27,910,232 K689N possibly damaging Het
Other mutations in Hoxa5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Hoxa5 APN 6 52204331 missense probably damaging 1.00
IGL01885:Hoxa5 APN 6 52202667 missense probably damaging 1.00
IGL02021:Hoxa5 APN 6 52202657 missense probably damaging 1.00
IGL02631:Hoxa5 APN 6 52203810 missense probably damaging 1.00
IGL02885:Hoxa5 APN 6 52202708 missense probably damaging 1.00
R0377:Hoxa5 UTSW 6 52202646 missense probably damaging 1.00
R0543:Hoxa5 UTSW 6 52204340 missense probably damaging 1.00
R1061:Hoxa5 UTSW 6 52204155 missense probably benign
R1460:Hoxa5 UTSW 6 52203948 missense probably benign 0.00
R1465:Hoxa5 UTSW 6 52203791 missense probably benign 0.37
R1465:Hoxa5 UTSW 6 52203791 missense probably benign 0.37
R1804:Hoxa5 UTSW 6 52202648 missense probably damaging 1.00
R1822:Hoxa5 UTSW 6 52202732 missense probably damaging 1.00
R2332:Hoxa5 UTSW 6 52202679 missense probably damaging 1.00
R4796:Hoxa5 UTSW 6 52203963 missense probably benign 0.01
R5642:Hoxa5 UTSW 6 52204217 missense probably damaging 1.00
R6212:Hoxa5 UTSW 6 52202714 missense probably damaging 1.00
R7134:Hoxa5 UTSW 6 52204043 missense probably damaging 1.00
R7172:Hoxa5 UTSW 6 52204296 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGTGACTAATGTGCAGC -3'
(R):5'- ACCGAGTACATGTCCCAGTC -3'

Sequencing Primer
(F):5'- TTGCGCATCCAGGGGTAGATC -3'
(R):5'- ACCGAGTACATGTCCCAGTCATTTC -3'
Posted On2015-06-20