Incidental Mutation 'R4303:Tax1bp1'
ID322491
Institutional Source Beutler Lab
Gene Symbol Tax1bp1
Ensembl Gene ENSMUSG00000004535
Gene NameTax1 (human T cell leukemia virus type I) binding protein 1
Synonyms1700069J21Rik, 1200003J11Rik, D6Ertd404e, D6Ertd772e, T6BP, TXBP151
MMRRC Submission 041090-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R4303 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location52713729-52766780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52727278 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 81 (V81A)
Ref Sequence ENSEMBL: ENSMUSP00000119522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080723] [ENSMUST00000129660] [ENSMUST00000138040] [ENSMUST00000149588]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080723
AA Change: V81A

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079548
Gene: ENSMUSG00000004535
AA Change: V81A

DomainStartEndE-ValueType
Pfam:CALCOCO1 15 416 2.6e-92 PFAM
coiled coil region 569 620 N/A INTRINSIC
ZnF_C2H2 753 778 7.57e1 SMART
ZnF_C2H2 780 805 3.21e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128173
Predicted Effect possibly damaging
Transcript: ENSMUST00000129660
AA Change: V81A

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122922
Gene: ENSMUSG00000004535
AA Change: V81A

DomainStartEndE-ValueType
Pfam:CALCOCO1 11 87 3.2e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000138040
AA Change: V81A

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119522
Gene: ENSMUSG00000004535
AA Change: V81A

DomainStartEndE-ValueType
Pfam:CALCOCO1 11 172 8.5e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149588
AA Change: V81A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000116059
Gene: ENSMUSG00000004535
AA Change: V81A

DomainStartEndE-ValueType
Pfam:CALCOCO1 11 161 2.3e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203787
Meta Mutation Damage Score 0.1065 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HTLV-1 tax1 binding protein. The encoded protein interacts with TNFAIP3, and inhibits TNF-induced apoptosis by mediating the TNFAIP3 anti-apoptotic activity. Degradation of this protein by caspase-3-like family proteins is associated with apoptosis induced by TNF. This protein may also have a role in the inhibition of inflammatory signaling pathways. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
PHENOTYPE: Knockout mice are born alive but fail to thrive and develop inflammatory cardiac valvulitis and dermatitis, die prematurely, and are hypersensitive to low doses of TNF and IL-1beta. In contrast, embryos homozygous for a gene trap mutation die at E13.5 from hemorrhaging and/or cardiac defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,401,057 S247P probably damaging Het
Atg4b A G 1: 93,768,262 E41G probably benign Het
Bckdk T C 7: 127,905,330 probably benign Het
Cacna2d1 A G 5: 16,302,248 probably null Het
Chaf1a A G 17: 56,044,068 D16G unknown Het
Defb12 A G 8: 19,112,721 I65T probably benign Het
Dnah7c T C 1: 46,748,578 Y3264H probably damaging Het
Ehhadh C A 16: 21,762,852 K463N probably damaging Het
Ehmt2 G A 17: 34,908,748 R901Q possibly damaging Het
Ern2 T C 7: 122,177,846 probably null Het
Esp6 A G 17: 40,565,144 T28A possibly damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Gm17333 A C 16: 77,852,879 noncoding transcript Het
Heatr5a T C 12: 51,956,225 T165A probably benign Het
Hoxa5 T C 6: 52,204,260 S31G probably benign Het
Ift80 A G 3: 68,894,174 I744T probably benign Het
Kalrn T C 16: 34,235,391 K853E probably damaging Het
Krt36 A T 11: 100,103,413 D279E possibly damaging Het
Map3k11 T A 19: 5,690,824 V193E probably damaging Het
Mrgpra4 T A 7: 47,980,936 M306L probably benign Het
Myo1a A G 10: 127,713,733 T428A probably benign Het
Nuggc A G 14: 65,611,172 H174R possibly damaging Het
Olfr293 G A 7: 86,663,955 V98M probably benign Het
Olfr389 A T 11: 73,776,838 M163K possibly damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Pik3ca C T 3: 32,439,935 R349* probably null Het
Rfxank T C 8: 70,136,212 D89G probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGTGGCGGCGG 7: 97,579,920 probably benign Het
Serpina1a A G 12: 103,854,675 L348P probably damaging Het
Shank1 A G 7: 44,342,474 Y701C unknown Het
Six4 G T 12: 73,112,540 D207E possibly damaging Het
Slco3a1 G T 7: 74,554,528 D21E probably benign Het
Sox6 C T 7: 115,544,469 probably null Het
Spta1 A G 1: 174,179,852 N216S probably damaging Het
Stard13 T C 5: 151,062,869 N392S possibly damaging Het
Trim29 G T 9: 43,311,122 V83L probably damaging Het
Vmn1r90 C T 7: 14,561,570 W201* probably null Het
Wdr31 T A 4: 62,460,389 N7I probably damaging Het
Ypel4 A G 2: 84,736,807 probably benign Het
Zfp39 T C 11: 58,890,017 K640E probably damaging Het
Zfp579 A G 7: 4,993,073 probably benign Het
Zfp974 C A 7: 27,910,232 K689N possibly damaging Het
Other mutations in Tax1bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02383:Tax1bp1 APN 6 52753366 missense probably benign 0.16
IGL03177:Tax1bp1 APN 6 52736947 missense possibly damaging 0.95
R0836:Tax1bp1 UTSW 6 52741940 splice site probably benign
R1119:Tax1bp1 UTSW 6 52741948 splice site probably benign
R1456:Tax1bp1 UTSW 6 52744244 missense probably benign 0.01
R1465:Tax1bp1 UTSW 6 52727194 splice site probably benign
R1484:Tax1bp1 UTSW 6 52733320 missense probably damaging 0.99
R1661:Tax1bp1 UTSW 6 52736912 missense probably benign 0.18
R1665:Tax1bp1 UTSW 6 52736912 missense probably benign 0.18
R1712:Tax1bp1 UTSW 6 52729326 missense probably damaging 1.00
R1752:Tax1bp1 UTSW 6 52721413 missense probably damaging 1.00
R1913:Tax1bp1 UTSW 6 52765952 missense probably damaging 1.00
R2496:Tax1bp1 UTSW 6 52758357 critical splice donor site probably null
R3782:Tax1bp1 UTSW 6 52739548 missense probably damaging 1.00
R3804:Tax1bp1 UTSW 6 52742785 missense probably benign 0.45
R4238:Tax1bp1 UTSW 6 52766051 nonsense probably null
R4665:Tax1bp1 UTSW 6 52737131 missense probably benign 0.00
R4870:Tax1bp1 UTSW 6 52729493 intron probably benign
R5009:Tax1bp1 UTSW 6 52729493 intron probably benign
R5965:Tax1bp1 UTSW 6 52729332 missense probably damaging 1.00
R6313:Tax1bp1 UTSW 6 52744356 critical splice donor site probably null
R6328:Tax1bp1 UTSW 6 52746709 missense probably benign 0.03
R6338:Tax1bp1 UTSW 6 52729376 nonsense probably null
R6886:Tax1bp1 UTSW 6 52733223 missense probably benign 0.43
R7251:Tax1bp1 UTSW 6 52721356 missense possibly damaging 0.95
R7531:Tax1bp1 UTSW 6 52746697 missense probably benign 0.00
R8225:Tax1bp1 UTSW 6 52744355 critical splice donor site probably null
RF020:Tax1bp1 UTSW 6 52721354 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGCATATTTTAACTTTAGGGTGT -3'
(R):5'- CCTGCAACACAACCTTTTCTTAAG -3'

Sequencing Primer
(F):5'- TTGGATGGAGTACTGCTC -3'
(R):5'- GCAGTGTTCTGAGTAGCTATGAAAAC -3'
Posted On2015-06-20