Incidental Mutation 'R4303:Zfp974'
ID322494
Institutional Source Beutler Lab
Gene Symbol Zfp974
Ensembl Gene ENSMUSG00000070709
Gene Namezinc finger protein 974
Synonyms1700049G17Rik
MMRRC Submission 041090-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R4303 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location27907392-27929460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 27910232 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 689 (K689N)
Ref Sequence ENSEMBL: ENSMUSP00000096238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098639] [ENSMUST00000129341]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098639
AA Change: K689N

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096238
Gene: ENSMUSG00000070709
AA Change: K689N

DomainStartEndE-ValueType
ZnF_C2H2 99 121 8.81e-2 SMART
ZnF_C2H2 127 149 1.82e-3 SMART
ZnF_C2H2 155 177 3.11e-2 SMART
ZnF_C2H2 201 223 2.15e-5 SMART
ZnF_C2H2 229 251 1.18e-2 SMART
ZnF_C2H2 257 279 1.47e-3 SMART
ZnF_C2H2 285 307 1.79e-2 SMART
ZnF_C2H2 313 335 2.24e-3 SMART
ZnF_C2H2 341 363 9.73e-4 SMART
ZnF_C2H2 369 391 7.26e-3 SMART
ZnF_C2H2 397 419 6.42e-4 SMART
ZnF_C2H2 425 447 3.63e-3 SMART
ZnF_C2H2 453 475 1.28e-3 SMART
ZnF_C2H2 481 503 1.26e-2 SMART
ZnF_C2H2 509 531 1.38e-3 SMART
ZnF_C2H2 537 559 3.83e-2 SMART
ZnF_C2H2 565 587 1.95e-3 SMART
ZnF_C2H2 593 615 4.61e-5 SMART
ZnF_C2H2 621 643 1.95e-3 SMART
ZnF_C2H2 649 671 1.03e-2 SMART
ZnF_C2H2 677 699 5.5e-3 SMART
ZnF_C2H2 705 727 2.37e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129341
SMART Domains Protein: ENSMUSP00000115940
Gene: ENSMUSG00000070709

DomainStartEndE-ValueType
KRAB 14 75 7.5e-37 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,401,057 S247P probably damaging Het
Atg4b A G 1: 93,768,262 E41G probably benign Het
Bckdk T C 7: 127,905,330 probably benign Het
Cacna2d1 A G 5: 16,302,248 probably null Het
Chaf1a A G 17: 56,044,068 D16G unknown Het
Defb12 A G 8: 19,112,721 I65T probably benign Het
Dnah7c T C 1: 46,748,578 Y3264H probably damaging Het
Ehhadh C A 16: 21,762,852 K463N probably damaging Het
Ehmt2 G A 17: 34,908,748 R901Q possibly damaging Het
Ern2 T C 7: 122,177,846 probably null Het
Esp6 A G 17: 40,565,144 T28A possibly damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Gm17333 A C 16: 77,852,879 noncoding transcript Het
Heatr5a T C 12: 51,956,225 T165A probably benign Het
Hoxa5 T C 6: 52,204,260 S31G probably benign Het
Ift80 A G 3: 68,894,174 I744T probably benign Het
Kalrn T C 16: 34,235,391 K853E probably damaging Het
Krt36 A T 11: 100,103,413 D279E possibly damaging Het
Map3k11 T A 19: 5,690,824 V193E probably damaging Het
Mrgpra4 T A 7: 47,980,936 M306L probably benign Het
Myo1a A G 10: 127,713,733 T428A probably benign Het
Nuggc A G 14: 65,611,172 H174R possibly damaging Het
Olfr293 G A 7: 86,663,955 V98M probably benign Het
Olfr389 A T 11: 73,776,838 M163K possibly damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Pik3ca C T 3: 32,439,935 R349* probably null Het
Rfxank T C 8: 70,136,212 D89G probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGTGGCGGCGG 7: 97,579,920 probably benign Het
Serpina1a A G 12: 103,854,675 L348P probably damaging Het
Shank1 A G 7: 44,342,474 Y701C unknown Het
Six4 G T 12: 73,112,540 D207E possibly damaging Het
Slco3a1 G T 7: 74,554,528 D21E probably benign Het
Sox6 C T 7: 115,544,469 probably null Het
Spta1 A G 1: 174,179,852 N216S probably damaging Het
Stard13 T C 5: 151,062,869 N392S possibly damaging Het
Tax1bp1 T C 6: 52,727,278 V81A possibly damaging Het
Trim29 G T 9: 43,311,122 V83L probably damaging Het
Vmn1r90 C T 7: 14,561,570 W201* probably null Het
Wdr31 T A 4: 62,460,389 N7I probably damaging Het
Ypel4 A G 2: 84,736,807 probably benign Het
Zfp39 T C 11: 58,890,017 K640E probably damaging Het
Zfp579 A G 7: 4,993,073 probably benign Het
Other mutations in Zfp974
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Zfp974 APN 7 27910890 missense possibly damaging 0.83
IGL01805:Zfp974 APN 7 27912264 splice site probably benign
IGL02313:Zfp974 APN 7 27912253 missense possibly damaging 0.53
IGL02449:Zfp974 APN 7 27911727 missense probably benign
R0362:Zfp974 UTSW 7 27927394 splice site probably benign
R0372:Zfp974 UTSW 7 27920695 critical splice donor site probably null
R0379:Zfp974 UTSW 7 27910932 missense probably damaging 0.98
R0699:Zfp974 UTSW 7 27911991 missense possibly damaging 0.56
R0791:Zfp974 UTSW 7 27910085 nonsense probably null
R1411:Zfp974 UTSW 7 27911209 missense probably benign 0.00
R1567:Zfp974 UTSW 7 27910723 missense probably damaging 0.99
R1747:Zfp974 UTSW 7 27911081 missense possibly damaging 0.61
R1837:Zfp974 UTSW 7 27910356 missense possibly damaging 0.93
R1838:Zfp974 UTSW 7 27910356 missense possibly damaging 0.93
R1839:Zfp974 UTSW 7 27910356 missense possibly damaging 0.93
R2311:Zfp974 UTSW 7 27910441 missense possibly damaging 0.73
R4006:Zfp974 UTSW 7 27912252 missense possibly damaging 0.86
R4541:Zfp974 UTSW 7 27926404 missense probably damaging 0.99
R4771:Zfp974 UTSW 7 27926308 missense probably damaging 0.96
R4889:Zfp974 UTSW 7 27910819 missense possibly damaging 0.86
R5332:Zfp974 UTSW 7 27926290 missense probably benign 0.01
R5537:Zfp974 UTSW 7 27912246 critical splice acceptor site probably benign
R5906:Zfp974 UTSW 7 27910805 missense possibly damaging 0.72
R5908:Zfp974 UTSW 7 27910957 missense probably benign 0.01
R6419:Zfp974 UTSW 7 27911515 missense possibly damaging 0.72
R6654:Zfp974 UTSW 7 27926403 missense probably damaging 1.00
R6731:Zfp974 UTSW 7 27911649 missense possibly damaging 0.93
R7162:Zfp974 UTSW 7 27911519 missense possibly damaging 0.71
R7316:Zfp974 UTSW 7 27910438 missense possibly damaging 0.93
R7484:Zfp974 UTSW 7 27912134 missense possibly damaging 0.72
R7663:Zfp974 UTSW 7 27911685 missense possibly damaging 0.74
R7664:Zfp974 UTSW 7 27910712 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GAAGGCCTGAGCTCAAATTG -3'
(R):5'- CAAGCCTATTGCACCATCGG -3'

Sequencing Primer
(F):5'- GGCCTGAGCTCAAATTGAAGTTC -3'
(R):5'- GCACCATCGGAAAATTCATTCTG -3'
Posted On2015-06-20