Incidental Mutation 'R4303:Olfr293'
ID322497
Institutional Source Beutler Lab
Gene Symbol Olfr293
Ensembl Gene ENSMUSG00000063394
Gene Nameolfactory receptor 293
SynonymsGA_x6K02T2NHDJ-9457744-9456734, MOR221-3
MMRRC Submission 041090-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R4303 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location86649061-86666045 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86663955 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 98 (V98M)
Ref Sequence ENSEMBL: ENSMUSP00000149959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081474] [ENSMUST00000214401] [ENSMUST00000215280]
Predicted Effect probably benign
Transcript: ENSMUST00000081474
AA Change: V98M

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000080193
Gene: ENSMUSG00000063394
AA Change: V98M

DomainStartEndE-ValueType
Pfam:7tm_4 35 313 2.1e-45 PFAM
Pfam:7tm_1 45 295 1.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214401
AA Change: V98M

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000215280
AA Change: V98M

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,401,057 S247P probably damaging Het
Atg4b A G 1: 93,768,262 E41G probably benign Het
Bckdk T C 7: 127,905,330 probably benign Het
Cacna2d1 A G 5: 16,302,248 probably null Het
Chaf1a A G 17: 56,044,068 D16G unknown Het
Defb12 A G 8: 19,112,721 I65T probably benign Het
Dnah7c T C 1: 46,748,578 Y3264H probably damaging Het
Ehhadh C A 16: 21,762,852 K463N probably damaging Het
Ehmt2 G A 17: 34,908,748 R901Q possibly damaging Het
Ern2 T C 7: 122,177,846 probably null Het
Esp6 A G 17: 40,565,144 T28A possibly damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Gm17333 A C 16: 77,852,879 noncoding transcript Het
Heatr5a T C 12: 51,956,225 T165A probably benign Het
Hoxa5 T C 6: 52,204,260 S31G probably benign Het
Ift80 A G 3: 68,894,174 I744T probably benign Het
Kalrn T C 16: 34,235,391 K853E probably damaging Het
Krt36 A T 11: 100,103,413 D279E possibly damaging Het
Map3k11 T A 19: 5,690,824 V193E probably damaging Het
Mrgpra4 T A 7: 47,980,936 M306L probably benign Het
Myo1a A G 10: 127,713,733 T428A probably benign Het
Nuggc A G 14: 65,611,172 H174R possibly damaging Het
Olfr389 A T 11: 73,776,838 M163K possibly damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Pik3ca C T 3: 32,439,935 R349* probably null Het
Rfxank T C 8: 70,136,212 D89G probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGTGGCGGCGG 7: 97,579,920 probably benign Het
Serpina1a A G 12: 103,854,675 L348P probably damaging Het
Shank1 A G 7: 44,342,474 Y701C unknown Het
Six4 G T 12: 73,112,540 D207E possibly damaging Het
Slco3a1 G T 7: 74,554,528 D21E probably benign Het
Sox6 C T 7: 115,544,469 probably null Het
Spta1 A G 1: 174,179,852 N216S probably damaging Het
Stard13 T C 5: 151,062,869 N392S possibly damaging Het
Tax1bp1 T C 6: 52,727,278 V81A possibly damaging Het
Trim29 G T 9: 43,311,122 V83L probably damaging Het
Vmn1r90 C T 7: 14,561,570 W201* probably null Het
Wdr31 T A 4: 62,460,389 N7I probably damaging Het
Ypel4 A G 2: 84,736,807 probably benign Het
Zfp39 T C 11: 58,890,017 K640E probably damaging Het
Zfp579 A G 7: 4,993,073 probably benign Het
Zfp974 C A 7: 27,910,232 K689N possibly damaging Het
Other mutations in Olfr293
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02478:Olfr293 APN 7 86664136 missense probably damaging 0.97
IGL02659:Olfr293 APN 7 86664081 missense probably benign 0.06
IGL02730:Olfr293 APN 7 86664067 missense probably damaging 0.98
IGL02959:Olfr293 APN 7 86664529 missense probably damaging 0.98
R0045:Olfr293 UTSW 7 86664340 missense possibly damaging 0.90
R0094:Olfr293 UTSW 7 86664294 missense probably benign
R0094:Olfr293 UTSW 7 86664294 missense probably benign
R0152:Olfr293 UTSW 7 86664511 missense probably damaging 1.00
R0669:Olfr293 UTSW 7 86664336 missense possibly damaging 0.79
R0942:Olfr293 UTSW 7 86664106 missense probably damaging 0.98
R1467:Olfr293 UTSW 7 86663977 missense possibly damaging 0.90
R1467:Olfr293 UTSW 7 86663977 missense possibly damaging 0.90
R1656:Olfr293 UTSW 7 86664123 missense probably benign 0.04
R2010:Olfr293 UTSW 7 86664603 missense probably benign
R2056:Olfr293 UTSW 7 86664383 missense probably damaging 1.00
R2059:Olfr293 UTSW 7 86664383 missense probably damaging 1.00
R2105:Olfr293 UTSW 7 86664383 missense probably damaging 1.00
R4166:Olfr293 UTSW 7 86664394 missense probably damaging 1.00
R4531:Olfr293 UTSW 7 86664271 missense probably benign 0.02
R4808:Olfr293 UTSW 7 86663938 missense probably benign 0.00
R5748:Olfr293 UTSW 7 86664085 missense possibly damaging 0.61
R5937:Olfr293 UTSW 7 86664476 missense probably benign 0.00
R6178:Olfr293 UTSW 7 86664611 missense probably benign 0.45
R6766:Olfr293 UTSW 7 86664085 missense probably damaging 0.98
R7315:Olfr293 UTSW 7 86664237 missense probably damaging 0.99
R7585:Olfr293 UTSW 7 86664672 makesense probably null
Predicted Primers PCR Primer
(F):5'- GCTGAGACTTGGGAACTCAG -3'
(R):5'- TAAGTAGGGAAGCCAGTGTCATC -3'

Sequencing Primer
(F):5'- TTGGGAACTCAGGATCCTACTCAG -3'
(R):5'- AGCCAGTGTCATCTGAATGC -3'
Posted On2015-06-20