Incidental Mutation 'R4303:Trim29'
ID322503
Institutional Source Beutler Lab
Gene Symbol Trim29
Ensembl Gene ENSMUSG00000032013
Gene Nametripartite motif-containing 29
Synonyms
MMRRC Submission 041090-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4303 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location43310848-43336115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 43311122 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 83 (V83L)
Ref Sequence ENSEMBL: ENSMUSP00000034511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034511]
Predicted Effect probably damaging
Transcript: ENSMUST00000034511
AA Change: V83L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034511
Gene: ENSMUSG00000032013
AA Change: V83L

DomainStartEndE-ValueType
Blast:BBOX 168 216 3e-25 BLAST
BBOX 220 260 1.93e-11 SMART
low complexity region 399 410 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TRIM protein family. It has multiple zinc finger motifs and a leucine zipper motif. It has been proposed to form homo- or heterodimers which are involved in nucleic acid binding. Thus, it may act as a transcriptional regulatory factor involved in carcinogenesis and/or differentiation. It may also function in the suppression of radiosensitivity since it is associated with ataxia telangiectasia phenotype. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,401,057 S247P probably damaging Het
Atg4b A G 1: 93,768,262 E41G probably benign Het
Bckdk T C 7: 127,905,330 probably benign Het
Cacna2d1 A G 5: 16,302,248 probably null Het
Chaf1a A G 17: 56,044,068 D16G unknown Het
Defb12 A G 8: 19,112,721 I65T probably benign Het
Dnah7c T C 1: 46,748,578 Y3264H probably damaging Het
Ehhadh C A 16: 21,762,852 K463N probably damaging Het
Ehmt2 G A 17: 34,908,748 R901Q possibly damaging Het
Ern2 T C 7: 122,177,846 probably null Het
Esp6 A G 17: 40,565,144 T28A possibly damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Gm17333 A C 16: 77,852,879 noncoding transcript Het
Heatr5a T C 12: 51,956,225 T165A probably benign Het
Hoxa5 T C 6: 52,204,260 S31G probably benign Het
Ift80 A G 3: 68,894,174 I744T probably benign Het
Kalrn T C 16: 34,235,391 K853E probably damaging Het
Krt36 A T 11: 100,103,413 D279E possibly damaging Het
Map3k11 T A 19: 5,690,824 V193E probably damaging Het
Mrgpra4 T A 7: 47,980,936 M306L probably benign Het
Myo1a A G 10: 127,713,733 T428A probably benign Het
Nuggc A G 14: 65,611,172 H174R possibly damaging Het
Olfr293 G A 7: 86,663,955 V98M probably benign Het
Olfr389 A T 11: 73,776,838 M163K possibly damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Pik3ca C T 3: 32,439,935 R349* probably null Het
Rfxank T C 8: 70,136,212 D89G probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGTGGCGGCGG 7: 97,579,920 probably benign Het
Serpina1a A G 12: 103,854,675 L348P probably damaging Het
Shank1 A G 7: 44,342,474 Y701C unknown Het
Six4 G T 12: 73,112,540 D207E possibly damaging Het
Slco3a1 G T 7: 74,554,528 D21E probably benign Het
Sox6 C T 7: 115,544,469 probably null Het
Spta1 A G 1: 174,179,852 N216S probably damaging Het
Stard13 T C 5: 151,062,869 N392S possibly damaging Het
Tax1bp1 T C 6: 52,727,278 V81A possibly damaging Het
Vmn1r90 C T 7: 14,561,570 W201* probably null Het
Wdr31 T A 4: 62,460,389 N7I probably damaging Het
Ypel4 A G 2: 84,736,807 probably benign Het
Zfp39 T C 11: 58,890,017 K640E probably damaging Het
Zfp579 A G 7: 4,993,073 probably benign Het
Zfp974 C A 7: 27,910,232 K689N possibly damaging Het
Other mutations in Trim29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02364:Trim29 APN 9 43311302 missense probably benign 0.05
IGL02387:Trim29 APN 9 43324852 missense probably benign 0.02
R1770:Trim29 UTSW 9 43332376 missense probably damaging 1.00
R1883:Trim29 UTSW 9 43311405 missense probably damaging 1.00
R1962:Trim29 UTSW 9 43311318 missense probably benign
R4198:Trim29 UTSW 9 43311380 nonsense probably null
R4200:Trim29 UTSW 9 43311380 nonsense probably null
R4863:Trim29 UTSW 9 43329575 missense possibly damaging 0.89
R4934:Trim29 UTSW 9 43310968 missense probably benign 0.36
R6171:Trim29 UTSW 9 43319377 missense probably damaging 1.00
R6737:Trim29 UTSW 9 43319384 missense probably benign 0.01
R6972:Trim29 UTSW 9 43327112 missense probably benign 0.01
R7191:Trim29 UTSW 9 43311609 missense probably damaging 1.00
R7434:Trim29 UTSW 9 43335131 missense probably damaging 1.00
R7588:Trim29 UTSW 9 43335128 missense probably damaging 1.00
R7590:Trim29 UTSW 9 43311491 missense probably damaging 1.00
X0065:Trim29 UTSW 9 43322324 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TACCATGGAAGGTGCCGATG -3'
(R):5'- GTAGCTATTCCTGCGGACTTCC -3'

Sequencing Primer
(F):5'- AAGGTGCCGATGCCTGC -3'
(R):5'- ACGATGGTCACCGTGGG -3'
Posted On2015-06-20