Incidental Mutation 'R4303:Olfr389'
ID322506
Institutional Source Beutler Lab
Gene Symbol Olfr389
Ensembl Gene ENSMUSG00000070383
Gene Nameolfactory receptor 389
SynonymsMOR135-6, GA_x6K02T2P1NL-3932085-3931147
MMRRC Submission 041090-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R4303 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73774849-73780713 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73776838 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 163 (M163K)
Ref Sequence ENSEMBL: ENSMUSP00000149734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122224] [ENSMUST00000124927] [ENSMUST00000215418]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118611
Predicted Effect possibly damaging
Transcript: ENSMUST00000122224
AA Change: M163K

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113364
Gene: ENSMUSG00000070383
AA Change: M163K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.8e-56 PFAM
Pfam:7TM_GPCR_Srsx 35 305 4.2e-6 PFAM
Pfam:7tm_1 41 290 2e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000124927
AA Change: M163K

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115639
Gene: ENSMUSG00000070383
AA Change: M163K

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 221 6.6e-7 PFAM
Pfam:7tm_1 41 224 3.5e-29 PFAM
Pfam:7tm_4 139 224 1.4e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215418
AA Change: M163K

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
Meta Mutation Damage Score 0.7208 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,401,057 S247P probably damaging Het
Atg4b A G 1: 93,768,262 E41G probably benign Het
Bckdk T C 7: 127,905,330 probably benign Het
Cacna2d1 A G 5: 16,302,248 probably null Het
Chaf1a A G 17: 56,044,068 D16G unknown Het
Defb12 A G 8: 19,112,721 I65T probably benign Het
Dnah7c T C 1: 46,748,578 Y3264H probably damaging Het
Ehhadh C A 16: 21,762,852 K463N probably damaging Het
Ehmt2 G A 17: 34,908,748 R901Q possibly damaging Het
Ern2 T C 7: 122,177,846 probably null Het
Esp6 A G 17: 40,565,144 T28A possibly damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Gm17333 A C 16: 77,852,879 noncoding transcript Het
Heatr5a T C 12: 51,956,225 T165A probably benign Het
Hoxa5 T C 6: 52,204,260 S31G probably benign Het
Ift80 A G 3: 68,894,174 I744T probably benign Het
Kalrn T C 16: 34,235,391 K853E probably damaging Het
Krt36 A T 11: 100,103,413 D279E possibly damaging Het
Map3k11 T A 19: 5,690,824 V193E probably damaging Het
Mrgpra4 T A 7: 47,980,936 M306L probably benign Het
Myo1a A G 10: 127,713,733 T428A probably benign Het
Nuggc A G 14: 65,611,172 H174R possibly damaging Het
Olfr293 G A 7: 86,663,955 V98M probably benign Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Pik3ca C T 3: 32,439,935 R349* probably null Het
Rfxank T C 8: 70,136,212 D89G probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGTGGCGGCGG 7: 97,579,920 probably benign Het
Serpina1a A G 12: 103,854,675 L348P probably damaging Het
Shank1 A G 7: 44,342,474 Y701C unknown Het
Six4 G T 12: 73,112,540 D207E possibly damaging Het
Slco3a1 G T 7: 74,554,528 D21E probably benign Het
Sox6 C T 7: 115,544,469 probably null Het
Spta1 A G 1: 174,179,852 N216S probably damaging Het
Stard13 T C 5: 151,062,869 N392S possibly damaging Het
Tax1bp1 T C 6: 52,727,278 V81A possibly damaging Het
Trim29 G T 9: 43,311,122 V83L probably damaging Het
Vmn1r90 C T 7: 14,561,570 W201* probably null Het
Wdr31 T A 4: 62,460,389 N7I probably damaging Het
Ypel4 A G 2: 84,736,807 probably benign Het
Zfp39 T C 11: 58,890,017 K640E probably damaging Het
Zfp579 A G 7: 4,993,073 probably benign Het
Zfp974 C A 7: 27,910,232 K689N possibly damaging Het
Other mutations in Olfr389
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Olfr389 APN 11 73776706 missense probably benign 0.44
IGL01766:Olfr389 APN 11 73777075 missense probably benign 0.41
IGL01771:Olfr389 APN 11 73776664 missense probably damaging 1.00
IGL02535:Olfr389 APN 11 73776616 missense probably benign 0.00
IGL02639:Olfr389 APN 11 73776545 missense probably benign 0.21
IGL03060:Olfr389 APN 11 73776463 missense probably damaging 1.00
IGL03075:Olfr389 APN 11 73776472 missense probably damaging 1.00
R0081:Olfr389 UTSW 11 73777109 missense possibly damaging 0.59
R0426:Olfr389 UTSW 11 73776437 missense probably benign 0.13
R1140:Olfr389 UTSW 11 73776854 missense probably benign
R1638:Olfr389 UTSW 11 73777148 missense possibly damaging 0.95
R2001:Olfr389 UTSW 11 73776713 missense probably benign
R2214:Olfr389 UTSW 11 73776829 nonsense probably null
R3076:Olfr389 UTSW 11 73776640 missense possibly damaging 0.93
R3077:Olfr389 UTSW 11 73776640 missense possibly damaging 0.93
R3078:Olfr389 UTSW 11 73776640 missense possibly damaging 0.93
R3081:Olfr389 UTSW 11 73777225 missense probably damaging 1.00
R3430:Olfr389 UTSW 11 73776539 missense probably damaging 1.00
R3731:Olfr389 UTSW 11 73776739 missense probably benign 0.08
R4090:Olfr389 UTSW 11 73776841 missense probably damaging 1.00
R4516:Olfr389 UTSW 11 73777040 missense probably benign 0.06
R4556:Olfr389 UTSW 11 73776481 missense possibly damaging 0.65
R4557:Olfr389 UTSW 11 73776481 missense possibly damaging 0.65
R4775:Olfr389 UTSW 11 73776551 missense probably damaging 1.00
R4858:Olfr389 UTSW 11 73776546 missense probably benign 0.44
R5015:Olfr389 UTSW 11 73777181 missense probably benign 0.07
R5087:Olfr389 UTSW 11 73777258 missense possibly damaging 0.75
R6599:Olfr389 UTSW 11 73776680 missense probably benign
R6701:Olfr389 UTSW 11 73776470 missense probably damaging 1.00
R6784:Olfr389 UTSW 11 73776850 missense probably damaging 1.00
R6916:Olfr389 UTSW 11 73777069 missense probably benign 0.00
R7066:Olfr389 UTSW 11 73777192 missense probably damaging 0.99
R7226:Olfr389 UTSW 11 73776677 missense possibly damaging 0.95
R7457:Olfr389 UTSW 11 73776826 missense probably benign 0.06
R7486:Olfr389 UTSW 11 73777021 missense probably damaging 1.00
R7990:Olfr389 UTSW 11 73776671 missense probably benign 0.00
R8289:Olfr389 UTSW 11 73777013 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTGTGTAGATGGGACCTTGAG -3'
(R):5'- TGCCTGACACAGCTGTACTTC -3'

Sequencing Primer
(F):5'- TGTAGATGGGACCTTGAGAATGG -3'
(R):5'- GACACAGCTGTACTTCTTTATGG -3'
Posted On2015-06-20