Incidental Mutation 'R4303:Nuggc'
ID322512
Institutional Source Beutler Lab
Gene Symbol Nuggc
Ensembl Gene ENSMUSG00000061356
Gene Namenuclear GTPase, germinal center associated
SynonymsGm600, SLIP-GC, LOC239151
MMRRC Submission 041090-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R4303 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location65598546-65648531 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65611172 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 174 (H174R)
Ref Sequence ENSEMBL: ENSMUSP00000118402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079469] [ENSMUST00000150897]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079469
AA Change: H190R

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000078434
Gene: ENSMUSG00000061356
AA Change: H190R

DomainStartEndE-ValueType
Pfam:Dynamin_N 119 372 2.2e-15 PFAM
low complexity region 406 421 N/A INTRINSIC
Blast:AAA 434 739 4e-14 BLAST
coiled coil region 758 792 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000150897
AA Change: H174R

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118402
Gene: ENSMUSG00000061356
AA Change: H174R

DomainStartEndE-ValueType
Pfam:Dynamin_N 103 356 6.1e-16 PFAM
low complexity region 390 405 N/A INTRINSIC
Blast:AAA 418 723 4e-14 BLAST
coiled coil region 742 776 N/A INTRINSIC
Meta Mutation Damage Score 0.1148 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased somatic mutation frequency immunoglobulin and non-immunoglobulin loci in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,401,057 S247P probably damaging Het
Atg4b A G 1: 93,768,262 E41G probably benign Het
Bckdk T C 7: 127,905,330 probably benign Het
Cacna2d1 A G 5: 16,302,248 probably null Het
Chaf1a A G 17: 56,044,068 D16G unknown Het
Defb12 A G 8: 19,112,721 I65T probably benign Het
Dnah7c T C 1: 46,748,578 Y3264H probably damaging Het
Ehhadh C A 16: 21,762,852 K463N probably damaging Het
Ehmt2 G A 17: 34,908,748 R901Q possibly damaging Het
Ern2 T C 7: 122,177,846 probably null Het
Esp6 A G 17: 40,565,144 T28A possibly damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Gm17333 A C 16: 77,852,879 noncoding transcript Het
Heatr5a T C 12: 51,956,225 T165A probably benign Het
Hoxa5 T C 6: 52,204,260 S31G probably benign Het
Ift80 A G 3: 68,894,174 I744T probably benign Het
Kalrn T C 16: 34,235,391 K853E probably damaging Het
Krt36 A T 11: 100,103,413 D279E possibly damaging Het
Map3k11 T A 19: 5,690,824 V193E probably damaging Het
Mrgpra4 T A 7: 47,980,936 M306L probably benign Het
Myo1a A G 10: 127,713,733 T428A probably benign Het
Olfr293 G A 7: 86,663,955 V98M probably benign Het
Olfr389 A T 11: 73,776,838 M163K possibly damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Pik3ca C T 3: 32,439,935 R349* probably null Het
Rfxank T C 8: 70,136,212 D89G probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGTGGCGGCGG 7: 97,579,920 probably benign Het
Serpina1a A G 12: 103,854,675 L348P probably damaging Het
Shank1 A G 7: 44,342,474 Y701C unknown Het
Six4 G T 12: 73,112,540 D207E possibly damaging Het
Slco3a1 G T 7: 74,554,528 D21E probably benign Het
Sox6 C T 7: 115,544,469 probably null Het
Spta1 A G 1: 174,179,852 N216S probably damaging Het
Stard13 T C 5: 151,062,869 N392S possibly damaging Het
Tax1bp1 T C 6: 52,727,278 V81A possibly damaging Het
Trim29 G T 9: 43,311,122 V83L probably damaging Het
Vmn1r90 C T 7: 14,561,570 W201* probably null Het
Wdr31 T A 4: 62,460,389 N7I probably damaging Het
Ypel4 A G 2: 84,736,807 probably benign Het
Zfp39 T C 11: 58,890,017 K640E probably damaging Het
Zfp579 A G 7: 4,993,073 probably benign Het
Zfp974 C A 7: 27,910,232 K689N possibly damaging Het
Other mutations in Nuggc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Nuggc APN 14 65623207 missense probably damaging 1.00
IGL01403:Nuggc APN 14 65623186 missense probably benign 0.01
IGL01413:Nuggc APN 14 65638581 missense probably benign 0.23
IGL02588:Nuggc APN 14 65617777 splice site probably benign
R0102:Nuggc UTSW 14 65613551 missense probably null 1.00
R0102:Nuggc UTSW 14 65613551 missense probably null 1.00
R0395:Nuggc UTSW 14 65613472 nonsense probably null
R0827:Nuggc UTSW 14 65608891 missense probably damaging 1.00
R1496:Nuggc UTSW 14 65624133 missense probably damaging 0.96
R1861:Nuggc UTSW 14 65642001 splice site probably benign
R1986:Nuggc UTSW 14 65641921 missense probably damaging 0.98
R1995:Nuggc UTSW 14 65611174 missense probably benign 0.02
R2283:Nuggc UTSW 14 65638612 missense possibly damaging 0.89
R2317:Nuggc UTSW 14 65624142 missense possibly damaging 0.81
R3799:Nuggc UTSW 14 65619638 missense probably benign 0.00
R3980:Nuggc UTSW 14 65619093 critical splice donor site probably null
R4431:Nuggc UTSW 14 65611210 missense probably benign 0.19
R4734:Nuggc UTSW 14 65623230 missense probably damaging 1.00
R5095:Nuggc UTSW 14 65635090 nonsense probably null
R5108:Nuggc UTSW 14 65638680 missense probably damaging 0.99
R5360:Nuggc UTSW 14 65638626 missense probably damaging 1.00
R5547:Nuggc UTSW 14 65641881 missense possibly damaging 0.87
R5636:Nuggc UTSW 14 65648188 nonsense probably null
R6494:Nuggc UTSW 14 65648222 missense probably damaging 1.00
R6922:Nuggc UTSW 14 65617643 missense probably damaging 1.00
R6971:Nuggc UTSW 14 65608856 missense probably benign 0.04
R7124:Nuggc UTSW 14 65608802 missense probably damaging 1.00
R7273:Nuggc UTSW 14 65619608 missense probably damaging 0.99
R7282:Nuggc UTSW 14 65617623 missense probably damaging 1.00
R7578:Nuggc UTSW 14 65648174 missense probably damaging 1.00
R7670:Nuggc UTSW 14 65613526 missense probably damaging 1.00
R7780:Nuggc UTSW 14 65645041 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCAGGACACTCATTTACAGG -3'
(R):5'- CTCCTCTGCCTTTAGAGTGATG -3'

Sequencing Primer
(F):5'- CTCATTTACAGGACAAGAGATTTGGG -3'
(R):5'- GGTTCTCGAGTTGGGAATCCTCC -3'
Posted On2015-06-20